ООО «Центр Грузовой Техники»

8(812)244-68-92

Содержание

Замена катализатора ниссан


Умер катализатор. Что будет, если вырезать его — журнал За рулем

Ваша машина станет очень вонючей. И это только одно следствие.

Как это работает?

Материалы по теме

Каталитический нейтрализатор призван очищать выхлопные газы методом доокисления до водяного пара и углекислого газа. Процесс проходит на поверхности керамических сот, покрытых тончайшей пленкой благородных металлов (платины, родия и палладия). Перед блоком каталитического нейтрализатора установлен первый, управляющий, датчик кислорода (лямбда-зонд). Он измеряет количество свободного кислорода в выпускных газах, и блок управления двигателем обеспечивает процесс сгорания в цилиндрах так, чтобы кислорода оставалось достаточно для доокисления вредных веществ в нейтрализаторе. За нейтрализатором ставят второй, диагностический, лямбда-зонд. Он проверяет, как прошел процесс нейтрализации — много ли осталось кислорода.

Почему вообще возникает идея вырезать каталитический нейтрализатор отработавших газов? Ведь очень немногие отключают сами у себя климат-контроль или, например, систему АБС.

Чем же это сравнительно новое устройство помешало?

Характерный пример расположения каталитического нейтрализатора под днищем автомобиля. Так выглядит большинство недорогих машин фирмы Renault на платформе Global Access/B0. На фото — Nissan Almera, автомобиль, созданный на той же платформе.

Характерный пример расположения каталитического нейтрализатора под днищем автомобиля. Так выглядит большинство недорогих машин фирмы Renault на платформе Global Access/B0. На фото — Nissan Almera, автомобиль, созданный на той же платформе.

Материалы по теме

Пока каталитические нейтрализаторы располагались под днищем автомобиля, они были безопасны для двигателей. Они честно очищали выхлоп от вредных примесей. Скончавшись, начинали мешать нормальной езде — и их вырезали. Керамический блок нейтрализатора при этом либо разваливался на куски, либо запекался коркой. В обоих случаях проход отработавших газов был затруднен.

Под днищем вместо нейтрализатора обычно вваривали трубу либо просто выбивали керамическую начинку. Пустая «бочка» могла «бубнить», придавала басовитости звуку выхлопа, и тогда в нее вваривали трубу с отверстиями, за которыми располагалась стальная проволока-путанка или стекловата. Это смягчало неприятный звуковой эффект.

Но прогресс не стоит на месте. Для более быстрого прогрева каталитический нейтрализатор стали устанавливать как можно ближе к двигателю. Все процессы нейтрализации, идущие при высокой температуре, при этом начнутся раньше. Нейтрализатор, совмещенный с выпускным коллектором, называется катколлектором.

Типичный катколлектор — такой ставят на популярнейшие автомобили Hyundai Solaris и Kia Rio.

Типичный катколлектор — такой ставят на популярнейшие автомобили Hyundai Solaris и Kia Rio.

Так вот в близости катколлектора и двигателя заключена главная опасность. Керамическая основа со временем начинает крошиться — образовавшиеся частички могут попадать в цилиндры двигателя. А цилиндропоршневая группа и абразивные частицы керамики — вещи несовместимые.

Возникают большие износы пары цилиндр-поршень и даже задиры. Мотор может потребовать капитального ремонта задолго до выработки среднего ресурса. Виновны в выкрашивании керамической основы нейтрализатора и низкое качество керамики, и плохое топливо, догорающее в катколлекторе, и присадки к бензину, которые использовал владелец автомобиля.

У разных производителей степень опасности повреждений моторов очень различается.

На отечественных моторах ВАЗ с шестнадцати- и восьмиклапанными моторами керамика достаточно крепкая, да и заброс частиц из-за особенностей газодинамических процессов практически невозможен.

На отечественных моторах ВАЗ с шестнадцати- и восьмиклапанными моторами керамика достаточно крепкая, да и заброс частиц из-за особенностей газодинамических процессов практически невозможен.

Другой пример — Kia Ceed. Вероятность повреждения мотора частицами керамики, если она начала сыпаться, относительно велика.

Другой пример — Kia Ceed. Вероятность повреждения мотора частицами керамики, если она начала сыпаться, относительно велика.

Решение или вредительство?

Каталитические нейтрализаторы на некоторых моторах начинают разрушаться при пробегах меньше 50 000 км. И владельцы, начитавшись страшилок, едут их ликвидировать. Удалить «каталик» можно двумя способами. Просто извлечь всю керамическую начинку и слои пристеночного уплотнителя. Только надо делать это на снятом устройстве, потому что можно затолкать частицы в цилиндры через открытые клапаны. Звук выхлопа после такой процедуры может стать несколько громче на определенных режимах. Кому это не нравится, вскрывают катколлектор и вместо керамических блоков вваривают пламегаситель.

Замена каталитического нейтрализатора Услуги и стоимость

Что такое каталитический нейтрализатор?

Каталитический нейтрализатор — это компонент, связанный с выбросами, который установлен в выхлопной трубе. Его цель — перегреть несгоревшие частицы в выхлопных газах, которые выбрасываются из двигателя. Во время работы двигателя каталитический нейтрализатор нагревается до рабочей температуры 500-1200 ° F. При этой температуре частицы в «грязных» выхлопных газах сгорают и превращаются в водяной пар и диоксид углерода.Катализатор внутри почти всегда состоит из драгоценных металлов, таких как платина, родий или палладий. Когда катализатор не может сжечь несгоревшие углеводороды в выхлопных газах, может возникнуть неприятный запах, может возникнуть резкий пробег или пропуски зажигания, или может загореться индикатор Check Engine.

Помните:

  • Для большинства автомобилей требуется приваривать вторичный каталитический нейтрализатор к выхлопным трубам. Мобильные механики могут выполнить эту услугу только в том случае, если у вас есть каталитический нейтрализатор прямой установки, купленный у дилера.
  • При замене каталитического нейтрализатора может потребоваться замена кислородных датчиков.
  • Симптомы каталитического нейтрализатора часто похожи на другие, более простые проблемы. Диагностируйте индикатор Check Engine в любое время, когда он загорается.

Как это делается:

  • Автомобиль поднят и опирается на домкраты
  • Неисправный катализатор снят
  • Установлен новый каталитический нейтрализатор, и автомобиль запущен на предмет утечек
  • Автомобиль спущен с домкрата
  • Автомобиль прошел дорожные испытания на предмет исправности

Наша рекомендация:

Если вы постоянно совершаете короткие поездки на автомобиле, каталитический нейтрализатор может быть недостаточно горячим, чтобы полностью сжечь углеводороды.Чтобы не допустить засорения каталитического нейтрализатора, время от времени отправляйтесь на 15-минутную поездку по шоссе. Это позволяет выхлопным газам достаточно нагреваться и сжигать любые отложения в каталитическом нейтрализаторе.

Какие общие симптомы указывают на необходимость замены каталитического нейтрализатора?

  • Проверьте, горит или мигает лампа двигателя
  • В автомобиле мало или совсем нет питания
  • Запах тухлых яиц в машине или из выхлопных газов
  • Низкая экономия топлива
  • Обратный и черновой ход

Насколько важна эта услуга?

Если каталитический нейтрализатор не работает эффективно, загорится индикатор проверки двигателя, и ваш двигатель может начать терять производительность. Если каталитический нейтрализатор засорится, индикатор двигателя начнет мигать, и ваш двигатель может заглохнуть или больше не запускаться. В крайних случаях, когда преобразователь засорен, создаваемое избыточное противодавление может фактически вызвать внутреннее повреждение двигателя. Если вы испытываете симптомы, связанные с неисправностью каталитического нейтрализатора, проверьте его как можно скорее.

.

6 Признаков плохого каталитического нейтрализатора и стоимость его замены (это не дешево)

Последнее обновление 31 августа 2020 г.

Каталитические нейтрализаторы (а не преобразователи кадиллака, как некоторые любят говорить) помогают удалять окись углерода (и другие токсичные газы), которые Автомобиль производит поступающий снаружи воздух, которым мы дышим. Хотя вполне вероятно, что вам никогда не придется ремонтировать или заменять свои, иногда они выходят из строя.

Ищете хорошее онлайн-руководство по ремонту? Щелкните здесь, чтобы увидеть 5 лучших вариантов.

Итак, каковы симптомы плохого каталитического нейтрализатора? Можно ли отремонтировать каталитический нейтрализатор? А во сколько обойдется замена каталитического нейтрализатора?

Продолжайте читать, чтобы получить общее представление о каталитических нейтрализаторах, узнать, какие признаки искать у неисправного кота и какие есть варианты устранения проблемы.

Что такое каталитический нейтрализатор?

Каталитический нейтрализатор, также известный как «кот», является частью выхлопной системы. Он расположен между выпускным коллектором и глушителем.

Большинство автомобилей на сегодняшний день имеют один каталитический нейтрализатор, но многие автомобили с двойным выхлопом имеют два (по одному на каждый комплект труб). Некоторые автомобили более высокого класса теперь имеют двух рядных котлов, что дополнительно снижает вредные выбросы газов.

Его задача — отфильтровать или «преобразовать» вредные газы (оксид азота, монооксид углерода и несгоревшие углеводороды), которые производит автомобиль, прежде чем они попадут в атмосферу. Эти токсичные газы почти в одиночку положили конец эре классических маслкаров в 70-х годах и являются причиной большей части смога в больших городах.

Как работает каталитический нейтрализатор?

После запуска автомобиля токсичные газы, вырабатываемые двигателем автомобиля, проходят через каталитический нейтрализатор. Внутренняя структура кошки состоит из сот из драгоценных металлов, таких как платина, палладий и родий.

При высокой температуре, на которую рассчитан каталитический нейтрализатор (около 800 градусов F), происходит химическая реакция, конечным результатом которой являются более безопасные элементы, выходящие из вашего глушителя, такие как кислород, вода и углекислый газ.

Что вызывает выход из строя каталитического нейтрализатора?

Как упоминалось ранее, большинство каталитических нейтрализаторов прослужат весь срок службы автомобиля. Но в некоторых случаях кошка испортится и ее нужно будет заменить.

Почти все проблемы с каталитическим нейтрализатором возникают из-за неисправности двигателя. Чаще всего это вызвано избытком топлива, попадающим в выхлопную систему из-за неправильной топливно-воздушной смеси, неисправных свечей зажигания, неправильного времени работы двигателя, неисправного датчика кислорода или других проблем, когда топливо выходит из камеры сгорания двигателя несгоревшим.

Когда это происходит, каталитический нейтрализатор достигает слишком высокой температуры и фактически начинает плавить внутренности кошки или разрушать сотовый материал. Результат — нефункционирующая кошка.

Кроме того, вышедшие из строя прокладки, плохие уплотнения клапанов или изношенные поршневые кольца могут привести к попаданию масла или антифриза в систему выпуска отработавших газов и покрытию керамического катализатора внутри преобразователя густой углеродной сажей.

Если это будет продолжаться достаточно долго, эти углеродные отложения забьют каталитический нейтрализатор, и он не сможет выполнять свою работу.В худшем случае поток выхлопных газов полностью блокируется, и в двигателе создается противодавление, что может вызвать перегрев и другие проблемы.

Наконец, кошке могут быть нанесены физические повреждения. Хотя это и не является обычным явлением, камни, дорожный мусор или выбоины могут повредить или расколоть внешнюю оболочку кошки или поддерживающие ее вешалки.

Каталитический нейтрализатор с вмятинами часто означает, что части хрупкого керамического катализатора отломились внутри и функциональность каталитического нейтрализатора ухудшается.

Признаки неисправности каталитического нейтрализатора

Вот 6 общих симптомов, позволяющих узнать, что ваш каталитический нейтрализатор засорен или неисправен.

№ 1 — Запах тухлого яйца из выхлопных газов

Если вы чувствуете запах тухлых яиц, это явный признак неисправности каталитического нейтрализатора. Бензин содержит небольшое количество серы, которая в процессе сгорания превращается в сероводород.

Каталитический нейтрализатор, который работает должным образом, преобразует сульфид с неприятным запахом в диоксид серы без запаха. Когда кошка плохая, конверсия не происходит, поэтому некоторые несгоревшие газы, содержащие вонючий сероводород, выходят из выхлопных газов.

# 2 — «Проверьте двигатель» горит

Если каталитический нейтрализатор вашего автомобиля вышел из строя или вышел из строя, на приборной панели загорится индикатор «Проверьте двигатель». Современные автомобили содержат кислородные датчики, которые могут контролировать эффективность каталитического нейтрализатора, проверяя уровни выхлопных газов.

Если эти датчики обнаруживают, что выхлопные газы не катализируются должным образом по какой-либо причине, загорится индикатор проверки двигателя. Тогда водитель будет знать, что что-то не так, хотя он не будет точно знать, в чем проблема, потому что свет может означать много разных вещей.

Лучше всего получить коды неисправностей из автомобиля с помощью диагностического сканирующего прибора. P0420 и P0430 — два общих кода неисправности, которые указывают на отказ каталитического нейтрализатора.

# 3 — Плохое ускорение

Одним из наиболее распространенных симптомов засорения каталитического нейтрализатора является нехватка мощности двигателя, особенно когда вы пытаетесь ускориться, например, когда вам нужно быстро обогнать другой автомобиль.

Когда накопление углерода внутри сотовой конструкции становится слишком большим или когда внутренние детали начинают плавиться из-за избыточного тепла от несгоревшего топлива, происходит частичная блокировка внутри каталитического нейтрализатора.

Ваш двигатель зависит от хорошего потока выхлопных газов для работы на пиковой мощности. Когда поток ограничен из-за забитого преобразователя, вы заметите нехватку мощности при ускорении, подъеме в гору или буксировке тяжелого груза.

В случае засорения из-за отложений нагара очистка каталитического нейтрализатора может помочь удалить засорение.

# 4 — Неудачный тест на выбросы

В большинстве регионов США каждые несколько лет требуется, чтобы ваш автомобиль проходил тест на смог, чтобы убедиться, что он правильно сжигает топливо и не выбрасывает опасные газы в атмосферу. Одна из наиболее частых причин неудач при проверке выбросов — плохой каталитический нейтрализатор.

В зависимости от вашего автомобиля, диагностика будет проводиться либо через порт OBD2 на вашем автомобиле (автомобили 1996 года выпуска или новее), либо через шланг, подключенный к концу выхлопной трубы, который напрямую измеряет уровни токсичных газов (автомобили, выпущенные до 1996 года. ).

# 5 — Дребезжащий шум

Если части сотового материала внутри каталитического нейтрализатора разорвутся из-за чрезмерного нагрева или повреждения, вы, вероятно, заметите дребезжащий звук, исходящий из-под вашего автомобиля на холостом ходу или во время движения.Шум часто бывает самым громким при запуске автомобиля.

Вы захотите заменить кошку как можно скорее, поскольку эти куски выбитого материала могут действительно попасть дальше по выхлопной системе и в глушитель. Эта блокировка может затем привести к остановке автомобиля и даже помешать вам снова завести автомобиль.

# 6 — Сниженная экономия топлива

Когда у вас заблокирован каталитический нейтрализатор, более низкий воздушный поток может привести к тому, что ваш автомобиль сожжет больше топлива, чем необходимо.В связи с вышеуказанным признаком плохого ускорения, когда у вас нет надлежащего потока выхлопных газов, вы вынуждены больше нажимать на педаль газа, поскольку это влияет на ускорение.

Это связано с тем, что двигатель впрыскивает больше топлива в цилиндры, что приводит к тому, что топливная смесь автомобиля намного богаче, чем необходимо.

Поскольку уменьшение расхода бензина является признаком многих других проблем, само по себе это не означает, что вам необходимо заменить каталитический нейтрализатор. Но в сочетании с одним из вышеперечисленных признаков это может быть хорошим показателем.

Стоимость замены каталитического нейтрализатора

Из-за драгоценных металлов, используемых в его конструкции (например, платины и палладия), замена каталитического нейтрализатора стоит недешево. Следует учитывать возраст и марку автомобиля, количество каталитических нейтрализаторов в автомобиле, а также то, является ли эта модель запчастью OEM или запасной частью.

Бензиновые двигатели — 1981 г. и новее

Почти все автомобили с бензиновыми двигателями, выпускаемые с 1981 г., имеют трехкомпонентный каталитический нейтрализатор.Эта конструкция более сложная, чем у старых автомобилей, что означает, что стоимость деталей также высока.

В среднем, ожидайте заплатить где-нибудь от 500 до 2200 долларов за замену каталитического нейтрализатора в новых автомобилях. Только запчасти будут стоить от 400 до 2000 долларов. Затраты на рабочую силу обойдутся вам в 75–150 долларов за расчетный час работы, необходимой для замены.

Бензиновые двигатели — до 1981 г. (и дизельные двигатели)

Автомобили с бензиновыми двигателями, построенные до 1981 г., и большинство дизельных двигателей (в любой год) имеют двухкомпонентные каталитические нейтрализаторы. Поскольку конструкция довольно проста, затраты на замену обычно ниже.

Общая стоимость замены каталитического нейтрализатора в этих старых автомобилях составит от 175 до 750 долларов . Вы будете платить от 100 до 600 долларов за запчасти и еще от 75 до 150 долларов за труд. Имейте в виду, что чем старше или реже автомобиль, тем дороже новый кот из-за дефицита.

Можно ли отремонтировать каталитический нейтрализатор?

Это зависит. Если вы считаете, что у вас просто грязный или забитый каталитический нейтрализатор, добавление очистителя каталитического нейтрализатора в газ может помочь устранить засорение.Это может занять более одного раза. Альтернативный и очень надежный метод очистки каталитического нейтрализатора — вынуть кошку и замочить ее в растворе лимонной кислоты на 6-8 часов.

Другой вариант — использовать гидроксид натрия. Вот хорошее видео, объясняющее процесс:

Если есть повреждение каталитического нейтрализатора, в том числе фрагменты сотовой части, отколовшиеся внутри, просто не стоит пытаться любой тип ремонта, даже если вы найдете людей в Интернете. говоря иначе.В таких случаях замена — действительно ваш единственный выход.

Как предотвратить засорение

Если вы регулярно путешествуете на автомобиле на короткие расстояния, углеводороды могут не сгореть полностью, потому что каталитический нейтрализатор не имеет возможности достаточно нагреться. Чтобы снизить вероятность засорения каталитического нейтрализатора, время от времени старайтесь водить автомобиль по шоссе примерно 10–15 минут.

Это создаст необходимое тепло внутри кошки, чтобы эффективно сжечь эти углеводородные отложения, чтобы ваша кошка бегала с максимальной эффективностью.

.

Nissan 350Z- INVIDIA Катализатор для замены трубы / нарада катализатора

На нужных продуктах с указанием запаса ниже по цене на указанном выше стандартном уровне. V praxi to znamená, že pokud jste nějaké námi nabízené zboží našli u konkurence levněji , dáme vám toto zboží za stejnou cenu jako konkurence.

Chci využít garanci ceny — Jak postupovat:

  1. Ověření před objednávkou — pokud si nejste jisti, jestli se podmínky na cenové grancete nzaktešíčí (tj.typ zboží, konkurenční nižší cenu, prodejce). Tyto informace ověříme a následně vám nabídneme stejné podmínky.
  2. Uplatnění v okamžiku odesílání objednávky — pokud si zboží u nás již objednáváte, nezapomeňte prosím do poznámky v samotném závěrurazávěružnáčíní uznávánáváš.

Podmínky pro uplatnění programu Cenové garance :

  • obchod musí nabízet zboží, které je určené pro český trh , a mělo by obsahovat i český víké 9 náván 900 www.heureka.cz стручок 90% (pokud má nižší, JE Velká pravděpodobnost, že zboží vůbec nedodá Nebo nastane Jiný závažný проблема)
  • ЗАКАЗНИК Musi Пресне identifikovat konkurenční Obchod, JE uvedené KDE zboží nabízené levněji
  • Musi се jednat о typově zcela shodné zboží
  • Musi се jednat о funkční Obchod с jasně identifikovatelným provozovatelem standardními podmínkami (velmi Caste jsou případy, KDY «obchodník» zboží vůbec Nema Nebo nabízí velmi Dlouhé dodací lhůty, напр. Pres 14 DNI)
  • V případě objednávky více položek zboží lze cenovou garanci uplatňovat pouze na položku (položky) z jednoho obchodu — není možné uplatňovat nižší cenu na každou položku zvlášt, tj.každou položku против jiném obchodu
  • odkaz на obchodníka Musi Byt uvedený против poznámce у objednávky Nebo oznámen prostřednictvím электронной Майлуу či telefonátu okamžitě ро odeslání objednávky
  • программу шкала Гаранс себе nevztahuje на kusový výprodej konkurence Akce Х + 1 Беслатно
  • Программа шкала Гаранс себе vztahuje на Текущий zboží
  • против případě, že konkurenční prodejce nabízí к zakoupenému zboží nějaké Darky navíc, Muze зАКАЗНИК požádat о zohlednění hodnoty těchto dárků — konkrétní rozhodnutí záleží на společné domluvě prodejce се zákazníkem

Гаранс ставок = Nejnižší читать больше на trhu a perfektní zákaznický servis.

.

Забился катализатор признаки


Как узнать, что забился катализатор в автомобиле: признаки и причины

При длительном использовании автомобиля возможны проблемы в работе системы, снижающей токсичность выхлопа. Первые признаки забитого катализатора появляются обычно при пробеге более 150-200 тысяч км. В отдельных случаях это неприятное событие наступает и раньше по самым разным причинам от заводского брака до нарушения правил эксплуатации двигателя.

Рис. 1 – «Устройство каталитического нейтрализатора»

Вместе с тем симптомы неисправности описываемого узла нередко схожи с неправильной работой других систем силового агрегата автомобиля. Возникает вопрос, как точно узнать, забит ли катализатор, и что делать в случае выявления данного дефекта. Статья посвящена разбору причин отказа узла, методам его диагностики и способам устранения поломки.

Признаки забитого катализатора

Одним из основных симптомов неисправности является снижение мощности мотора и заметное ухудшение динамики автомобиля. Проявляется это заметным уменьшением максимальной скорости и вялым разгоном при старте с места от светофора или при обгоне. Существуют и другие

почему нужно срочно решать проблему

Каталитический нейтрализатор или просто катализатор представляет собой важный элемент в устройстве выхлопной системы современного автомобиля. Если просто, автомобильные катализаторы – это своеобразные фильтры, которые установлены в выхлопной системе и активно взаимодействуют с  проходящими через них отработавшими газами. 

Основная задача состоит в том, чтобы добиться снижения уровня токсичных выбросов в атмосферу посредством восстановления оксидов азота, а также эффективного дожига угарного газа, не сгоревших углеводородов и т.д. Так вот, катализатор в автомобиле изнутри покрыт особыми веществами, которые при их нагреве позволяют ускорять химические реакции во время контакта с выхлопом.

Само собой, пока система работает нормально, выхлопные газы свободно проходят через каталитический нейтрализатор и очищаются должным образом. Однако если возникла проблема с катализатором (например, забился катализатор), в этом случае игнорировать неполадки никак нельзя и необходимо немедленно принимать меры.

Содержание статьи

Автомобильный катализатор: признаки неисправности и почему возникают проблемы

Итак, важно понимать, что забитый катализатор не позволит выхлопу нормально выходить наружу. Результатом становится ухудшение вентиляции и рост давления в системе, а также целый ряд других проблем.  Чтобы вовремя заметить неполадки, необходимо знать основные признаки забитого катализатора.

  • Как правило, на большинстве авто в случае забитого катализатора двигатель может заводиться с трудом, глохнуть после запуска;
  • Зачастую на приборной панели горит «чек» двигателя;
  • Отмечается заметная потеря мощности, автомобиль теряет в динамике, при нажатии на газ отклик слабый, заметно увеличивается расход горючего и моторного масла;
  • Во время холодного пуска двигателя появляется характерный и резкий запах, которого ранее не было;
Что касается причин, по которым катализатор забивается или выходит из строя, таких причин существует достаточно много. Важно понимать, что ошибки при эксплуатации и любые сбои в работе ДВС влияют на катализатор. Например, если заливать топливо низкого качества с большим содержанием свинца, нейтрализатор выйдет из строя намного раньше положенного срока.

В случае, когда неисправен сам двигатель или  его системы (например, изношена ЦПГ или залегли кольца), возникает увеличенный расход моторного масла. В свою очередь, это масло горит в цилиндрах, активно попадает в выхлоп и «убивает» катализатор.

То же самое можно сказать и о случаях, когда мотор по той или иной причине троит, появляются пропуски зажигания. В такой ситуации горючее не сгорает в цилиндре, остатки топлива и моторное масло попадают в выхлопную систему, загрязняя и выводя из строя каталитический нейтрализатор. 

Еще данный фильтр достаточно хрупкий. Его могут выводить из строя механические повреждения (например, при небрежной эксплуатации авто или агрессивной езде в сложных условиях), а также поломки самой выхлопной системы.

При этом важно понимать, что забитый катализатор является достаточно серьезной проблемой и напрямую влияет не только на токсичность выхлопа, но и на сам двигатель. Другими словами, игнорировать неполадки и ездить с забитым катализатором настоятельно не рекомендуется!

Главное, помнить, что забитый катализатор может сильно навредить ДВС. Дело в том, что в случае физического разрушения катализатора его части могут попадать в цилиндры, что станет причиной серьезных неисправностей или капитального ремонта мотора.

Вполне очевидно, если проявилась неисправность катализатора, независимо от класса автомобиля (катализатор ВАЗ или авто премиальных марок) необходимо выполнить диагностику и устранить неисправность одним из доступных методов, о которых мы поговорим ниже. 

Как проверить катализатор на машине

Как видно, причин для выхода из строя катализатора много. Это может быть качество топлива, сбои в системе зажигания, общее состояние ДВС и т.д. Так или иначе, если двигатель потерял мощность, на панели горит «чек», а также появился нехарактерный шум (напоминает стук мелкого щебня в области выпускного коллектора, звон при разгоне), необходимо проверять катализатор.

Как правило, на начальном этапе нужно провести визуальный осмотр и оценку запаха выхлопа. Если после активной езды загнать машину на яму или на подъемник, можно увидеть, что катализатор раскалился. В данном случае предельный нагрев может указывать на то, что он забит. Также о проблемах говорит и слишком едкий и резкий запах при запуске ДВС «на холодную».

Еще один простой способ быстрой проверки катализатора — метод, в рамках которого следует приложить руку к выхлопной трубе и почувствовать, насколько свободно проходят выхлопные газы.  Если возникли подозрения, тогда нужна более глубокая диагностика. 

Параллельно в ситуации, когда горит «чек», следует сначала выполнить компьютерную диагностику, однако чтобы проверить автомобиль именно на предмет забитого катализатора, желательно применение следующих способов:

  • Проверка на противодавление, когда измеряется давление выхлопа, после чего его сравнивают с оптимальными показателями. Чтобы выполнить диагностику, нужен манометр, а также переходник, чтобы его подключить. Далее снимается первый лямбда-зонд и на его место через переходник подсоединяется манометр.  Главное, получить максимальную герметичность соединения. После остается завести мотор, погазовать до 3000 тыс. об/мин в течение 10-15 сек. и фиксировать данные с манометра.
  • Средние данные таковы: если давление составляет 0.3 кгс/см2, тогда все в порядке, если показатель 0.35 кгс/см2 для ДВС без тюнинга, тогда показания превышают норму.  Кстати, если мотор доработан, а давление составляет от 0.5 кгс/см2, тогда это тоже говорит о проблемах с катализатором.

Еще добавим, что проверку катализатора также можно выполнить при помощи мотор-тестера. В двух словах, это спецоборудование, которое определяет множество параметров на основе осциллограммы. Устройство ставится в двигатель вместо свечи зажигания, после чего силовой агрегат запускают и диагностируют.  Полученные данные позволяют сделать вывод о состоянии катализатора.

Ремонт и замена катализатора

Начнем с того, что катализатор не ремонтируется. Выходом в сложившейся ситуации является или замена устройства, или удаление катализатора. С учетом высокой стоимости такой детали (даже более дешевых универсальных аналогов), второй вариант по удалению нейтрализатора повсеместно практикуется в странах СНГ.

Если просто, из катализатора удаляются вставки из керамики, после чего пустую «болванку» ставят на место. Параллельно штатную прошивку ЭБУ автомобиля корректируют, также может потребоваться поставить обманку лямбда-зонда и т.д. Главное, чтобы двигатель нормально работал без катализатора.

Еще есть вариант сразу вырезать катализатор и поставить пламегаситель (труба с отверстиями). Такое решение позволяет эффективно отводить выхлопные газы, двигатель работает мягче, улучшается приемистость, однако звук выхлопа становится более громким, а также страдает сама выхлопная система и сокращается ее ресурс.

Подведем итоги

С учетом приведенной выше информации становится понятно, что в современных автомобилях катализатор является важным элементом, который в связке с кислородным датчиком оказывает прямое влияние на смесеобразование и работу двигателя в целом. Также проблемы с катализатором могут привести к сбоям в работе ДВС в том случае, если фильтр забит.

По этой причине следует обращать внимание на любые признаки, которые могут указывать на неисправности каталитического нейтрализатора. Дело в том, что не редко отмечаются случаи, когда части разрушенных элементов нейтрализатора отработавших газов попадали в двигатель со всеми вытекающими последствиями.

Напоследок отметим, что замена каталитического нейтрализатора является наиболее правильным решением, однако если нет средств на покупку новой детали, можно ограничиться установкой пламегасителя. Хотя уровень токсичности выхлопа в данном случае сильно повышается и не соответствует нормам и стандартам, владелец получает возможность нормально эксплуатировать автомобиль с исправно работающим ДВС.  

Читайте также

7 признаков забитого катализатора — Статьи

Катализатор – это составная часть выхлопной системы. Если он забит, то не выполняет свою функцию по нейтрализации выпускаемых машиной вредных веществ. Если забит катализатор, как ведет себя машина?

Признаки забитого катализатора выхлопных газов:

  1. двигатель заводится и сразу глохнет;
  2. машина стала медленно разгоняться;
  3. при нажатии на педаль газа чувствуется сопротивление;
  4. забитый катализатор расход топлива сильно увеличился;
  5. при запуске двигателя «на холодную» чувствуется неприятный резкий запах;
  6. горит индикатор «проверьте двигатель»;
  7. увеличился расход масла.
Узнайте стоимость диагнотики катализатора онлайн за 3 минуты

Не традте время в пустую, воспользуйтесь поиском Uremont и получите предложения от ближайших сервисов с конкретными ценами

Забитый катализатор. Каковы причины?

Причинами некорректной работы каталитического нейтрализатора становятся разные факторы. Основными из них являются следующие: топливо низкого качества (мотор хуже «дышит»), большой расход масла, неправильная настройка системы зажигания, механические повреждения, некорректная работа выхлопной системы. Из-за этих факторов фильтр забивается.

Как выглядит забитый катализатор? Лучше один раз увидеть, чем 100 раз прочитать. На фото показан забитый катализатор.

В отечественных автомобилях (ВАЗ, Калина, Лада Приора, Нива) частой причиной поломки становятся неполадки в системе зажигания.

Проблемы у иномарок (Ниссан, Опель, Пежо, Форд, Солярис, Ауди, Лачетти, Лансер) идентичны: теряется мощность, в корпусе слышен шум, как от мелкого щебня, двигатель работает нестабильно.

Расход масла при забитом катализаторе

При неисправной работе двигателя автомобиль «жрет» масло. Это связано с выходом из строя маслосъемных колец. Они могут истончиться из-за трения о стенки. Остатки масла попадают на каталитический фильтр и забивают его. Выхлопные газы синего цвета говорят о неисправности маслосъемных колец. Таким образом, автомобиль «жрет» масло, то есть оно сгорает и его уровень значительно падает.

Забило катализатор. Как самому проверить?

Вы можете сами диагностировать поломку при помощи своих органов чувств: — Посветите мощным фонарем вовнутрь детали, чтобы визуально идентифицировать неисправность. Для удобства поднимите машину на кронштейне, если есть такая возможность. — Принюхайтесь. Если катализатор источает резкий и неприятный запах, то поломка налицо. — Подставьте руку к выхлопной трубе. Если тактильно вы чувствуете сопротивление, то катализатор исправен. Если нет, то есть необходимость в ремонте.

Ремонт каталитического нейтрализатора

Удаление нейтрализатора выглядит так: из катализатора извлекаются керамические детали, а далее монтируется обратно уже пустой блок. Там, где у автомобиля есть «мозги», требуется еще и «перепрошивка».

При замене на пламегаситель вместо испорченной начинки устанавливают трубу с множеством отверстий. Свободное пространство заполняется базальтовой ватой. Это дешево, требования к качеству бензина снижаются, долго служит, не оказывает сопротивления газам (работа двигателя облегчается). Из недостатков: звук выхлопа громче, выхлопная система прослужит меньше из-за высокой температуры газов. Состав выхлопа не соответствует нормам.

Также можно установить универсальный катализатор. Сама деталь и ее монтаж стоят дешево. Это хорошая альтернатива, когда средств на оригинальный катализатор не хватает.

Самостоятельно его заменить, обладая навыками сварочных работ, возможно. Снимаете трубу, вырезаете «болгаркой» старую трубу, ввариваете другой.

Последствия, если не починить катализатор

На что влияет забитый катализатор? Сегодня в 80% случаев эксплуатация авто с неисправным катализатором может привести к замене ДВС. Во-первых, есть риск не завести двигатель. Во-вторых, при физическом разрушении элемента керамические частицы могут попасть в цилиндры. В этом случае понадобится капитальный ремонт.

В заключение скажем, что во многих современных автомобилях компьютер проинформирует автовладельца о неисправности. Для диагностики самостоятельной проблемы с фильтром вы можете ориентироваться по признакам, которые мы указали в этой статье. Замена каталитического фильтра в случае поломки – это лучшее решение. Также существует дешевая альтернатива: установить пламегаситель. Он гасит шум и температуру, но не решает проблему с загрязнением окружающей среды.

Признаки и симптомы засорения катализатора автомобиля.

14.08.2019
Признаки засорения катализатора

Содержание

Признаки засорения катализатора, проверка    

Забился катализатор. Как это понять

Когда катализатор разрушен. Первые симптомы

Как проверить целостность катализатора

Симптомы забитого керамического элемента

Забился катализатор. Что теперь?

Относиться к катализатору как к порождению зла, неправильно. Другое дело, что стоит он сумасшедших денег, если менять изношенный или разбитый на новый. Замена катализатора проводится только в тех случаях, когда пробег автомобиля не превышает 70-90 тысяч км или раньше. Однако выйти из строя нейтрализатор может и раньше. Поэтому важно знать, как его проверить, чтобы не совершать необдуманных трат.

 

Забился катализатор. Как это понять

Каждый владелец автомобиля с каталитическим нейтрализатором должен понимать, что это непростое устройство и не просто лишняя банка в системе выхлопа, которую можно просто вырезать безболезненно. В зависимости от того, каким экологическим стандартам соответствует двигатель (Евро2, Евро3, Евро4 и выше), сложность конструкции нейтрализатора будет разной.

В катализаторе может быть установлен один, два или четыре датчика кислорода, каждый из которых может выйти из строя в любой момент, тем самым подводя под подозрение керамический элемент и систему дожига несгоревшего топлива. Кроме того, катализатор может пострадать от механического разрушения, химического, что приведет к ремонту системы выхлопа и замене всего устройства.

Когда катализатор разрушен. Первые симптомы

Забитый катализатор — результат естественного износа керамического элемента. В этих случаях есть шанс восстановить устройство, расшив банку и прочистив элемент, но это не факт. Другое дело, когда элемент разрушен. Здесь последствия будут необратимыми. Для восстановления работоспособности двигателя придется либо заменять нейтрализатор полностью, либо искать б/у элемент, либо устанавливать пламегаситель.

Существует ряд симптомов, при которых можно самостоятельно, либо с помощью мастера, выяснить, разрушен ли катализатор:

  1. Низкая пропускная способность катализатора. Может говорить как о разрушении (механическом или химическом), так и о забитом элементе. Давление в выхлопной системе до и после здорового нейтрализатора должно быть практически идентичным. Визуально это можно выяснить по интенсивности выхлопа, по звуку, по сравнению давления выхлопа из глушителя на здоровом автомобиле и на тестируемом — менее интенсивный выхлоп будет говорить о проблеме с керамическим элементом.
  2. Явный запах сероводорода при работе двигателя. Это самый яркий маркер того, что катализатор разрушен.
  3. Повышенный расход топлива на фоне полностью исправной системы питания, зажигания, чистом воздушном фильтре и нормальной рабочей температуре во время движения. Двигатель начинает потреблять топливо сверх нормы по причине того, что вышедший из строя нейтрализатор не в состоянии поддерживать оптимальную температуру дожига бензина.

    К примеру, если на катализаторах, соответствующих стандарту Евро4 нормальная температура дожига должна быть в пределах 500-760 °С, то неисправный элемент с помощью датчика кислорода посылает на электронный блок управления двигателем данные, согласно которым ЭБУ добавляет бензин для повышения температуры дожига. Этого, естественно, не происходит, поэтому лишний бензин просто скапливается в глушителе или испаряется, что может привести к взрыву паров и выходу глушителя из строя.

  4. Характерный металлический стук при резком увеличении оборотов или разгоне. Это верный признак того, что керамический элемент имеет механические повреждения или же смещен со своего законного места, свободно перемещается по банке. Такой катализатор тоже работать не будет.
Как проверить целостность катализатора

Разрушенный или поврежденный катализатор проверяется только визуально. Для этого можно спуститься под автомобиль и внимательно осмотреть корпус. Вмятины, следы прогара, потемнения, трещины на корпусе будут свидетельствовать о необходимости выполнить ремонт глушителя.

Более трудоемкий, но верный метод проверки керамического элемента — визуальный осмотр сот. Для этого придется разобрать систему выхлопа, а лучше — снять катализатор и внимательно осмотреть торцы элемента. Забитые или разрушенные соты будут видны сразу.

Еще один эффективный способ — проверка давления в системе выпуска до и после катализатора. Для этого будет необходим манометр и резьбовой переходник. Чтобы измерить давление перед катализатором, выкручиваем первый лямбда-зонд, вкручиваем манометр и оцениваем давление в зоне средних оборотов, около 3-4 тысяч. После этого проводится замер на втором датчике кислорода. Большой перепад давления будет говорить о разрушенном или забитом катализаторе. Номинал давления в выхлопной системе у каждой модели двигателя свой.

 

Симптомы забитого керамического элемента

До тех пор, пока мы не видим состояние керамического элемента, мы можем судить о его целостности и уровне засорения только по вторичным симптомам. Некоторые из них мы уже рассмотрели, в том числе, самую действенную проверку — проверку давлением и визуальный осмотр.

Тем не менее опытный водитель может сделать вывод о том, что соты катализатора забиты по дополнительным признакам:

  1. Пропадает тяга и динамика разгона. Это слишком расплывчатый симптом, но если мы знаем точно, что остальные системы работают идеально, при снижении разгонной динамики и проявлении хотя бы еще одного симптома, можно говорить о забитом нейтрализаторе.
  2. Пропадает тяга на высоких оборотах при полностью рабочем двигателе. Если на низких оборотах мощность сильно зависит от настроек системы впрыска и ГРМ, а также системы зажигания, то на верхах снижение тяги может вполне говорить о неисправности катализатора.
  3. Появление ошибок, загорается лампа Check Engine. В этом случае неисправность определить проще, если есть опыт работы с простейшим диагностическим оборудованием — сканером OBD II и соответствующим программным обеспечением.

Появление ошибок на бортовом компьютере и их расшифровка помогут определить состояние не только самого керамического элемента катализатора, но и датчиков кислорода и цепей, связанных с ними.

В ряде случаев, при сильно забитом катализаторе, двигатель может вполне нормально запускаться, но после прогрева терять мощность или просто глохнуть. Все попытки запустить его на горячую могут ни к чему не привести. История усугубляется тем, что при забитом керамическом элементе система самодиагностики не выявит никаких сбоев и не сообщит об ошибке. Это объясняется тем, что в бензиновом двигателе чаще всего пропускная способность катализатора контролю не подвергается.

Забился катализатор. Что теперь?

А теперь нужно думать. В Европе за автомобилистов эту проблему решили официальные дилеры, партнерские компании и экологи. Чтобы не заставлять владельцев загрязнять окружающую среду и удалять катализатор из системы, в странах ЕС принимают старые катализаторы в обмен на новые. С доплатой, конечно, но на толстом европейском кошельке это не отображается практически никак. Более того, если автомобиль прошел более 100 000 км, независимо от состояния катализатора, его нужно менять.

 

Нам же нужно решать и выбирать из нескольких вариантов выхода из положения:

  1. Покупка нового катализатора. Хорошо, но дорого. К примеру, новый катализатор на Форд Фокус 3 обойдется от $400 до $800 в зависимости от качества, производителя, типа элемента и качества керамики. Это с одной стороны, хорошо, поскольку ближайших 100 тысяч км автомобиль без всякого вмешательства в электронные системы будет соответствовать экологическим нормам. С другой стороны, за эти деньги можно найти решение эффективнее.
  2. Навсегда забыть о проблемах с катализатором можно гораздо дешевле, установив пламегаситель из хорошей нержавеющей стали. При этом необходима перепрошивка электронного блока управления двигателем.

Есть возможность временно снять вопрос с катализатором, попробовав отмыть старый, если он в хорошей физической форме, не поврежден и не потерял геометрию. В любом случае, специалисты компании решат любую проблему с глушителем быстро и недорого с гарантией качества выполненных работ.


Признаки неисправности и симптомы забитого катализатора

Сегодня мы поговорим про признаки неисправности катализаторов. Многие автовладельцы считают, что это устройство вечное, но, к сожалению это далеко не так.

Каталитический нейтрализатор – зачем он?

Конструкторы автомобилей все больше внимания обращают на снижение вредных выбросов.

Для этого модернизируются системы питания силовых установок, чтобы добиться как можно меньшего потребления топлива, при этом не оказывая влияния на мощностные показатели.

Также все больше автомобилей укомплектовываются каталитическими нейтрализаторами, установленными в систему отвода выхлопных газов.

Суть работы катализатора сводится к расщеплению вредных элементов на безвредные за счет химических реакций.

Состоит каталитический нейтрализатор из корпуса, внутри которого помещен активные катализаторы, так называемые бобины.

Сейчас эти бобины зачастую изготавливаются из керамики, но есть и сделанные из металла.

В бобине сделано большое количество сот, через которые и проходят выхлопные газы.

Но керамика в химическую реакцию не вступает, для этого поверхность сотов покрыта слоем благородных металлов – платиной, иридия. Благодаря этим металлам и происходит реакция, в результате которой снижается вредность выбросов авто.

Эффективность работы данного устройства зависит от температуры – оптимальной считается от 300 град., поэтому внутри корпуса имеется также теплоизоляционный слой, а сам элемент размещается как можно ближе к выхлопному коллектору.

Более подробно о конструктивных особенностях каталитического нейтрализатора, а также о принципе его работы можно почитать здесь.

Одним из основных недостатков каталитического нейтрализатора является его сравнительно недолгий срок службы. В среднем он рассчитан на 100-120 тыс. км, после чего он становится не рабочим.

Признаки неисправности катализатора

Однако выйти из строя катализатор может и значительно раньше. Основным признаком нерабочего каталитического нейтрализатора является загоревшаяся лампочка «Check Engine» и переход работы мотора в аварийный режим.

Сканирование же ошибки в таком случае показывает на нарушение работы данного элемента. Но сразу это происходит только в случае повреждения корпуса катализатора или обрыва проводки одного из лямбда-зондов.

Но нарушение работы катализатора может идти постепенно, не доходя до появления сигнала «Check Engine».

В таком случае неисправность проявляется в виде падения мощности двигателя, снижения динамики набора скорости и затрудненного пуска.

Зачастую виной падения мощности является закупорка сотов бобины сажей, из-за чего пропускная способность катализатора падает.

В результате не успевшие пройти катализатор газы «задавливают» двигатель.

В целом это равносильно полной закупорке выхлопной трубы, из-за чего двигатель попросту не сможет работать.

Механическое разрушение сот, а также их оплавление тоже может стать причиной падения мощности.

Сигнал «Check Engine» дополнительно может вызвать и стирание слоев платины или иридия, из-за чего свою функцию катализатор не выполняет и это «замечает» лямбда-зонд, установленный за нейтрализатором.

Дополнительным признаком забитого катализатора может стать поток выхлопных газов из трубы.

При нормально работающем катализаторе поток газов настолько мощный, перекрыть трубу рукой затруднительно. А вот если катализатор забит, то поток будет очень слабым.

К тому же из-за нерабочего катализатора поменяется запах отработанных газов, поскольку количество СО на выходе из трубы значительно увеличится, поэтому в выхлопе добавится запах «тухлых» яиц.

Особенности забития катализатора на разных авто

Пройдемся по разным моделям авто, оснащенных данным устройством, чтобы более явно определить, что забит каталитический нейтрализатор.

Начнем с отечественных моделей – ВАЗ 2110, 2114, «Калина».

Итак, помимо того, что автомобиль на низких оборотах «тупит», разгон происходит медленно, неисправность катализатора на этих моделях может выдать появившийся звук под авто, как будто в корпус катализатора насыпали мелкого щебня.

Такой звук является четким сигналом того, что произошло механическое разрушение бобины, из-за чего она рассыпалась на мелкие части.

В целом выявить забитие или оплавление катализатора на ВАЗ иногда бывает достаточно сложно, ведь такие признаки могут быть и из-за проблем с другими элементами авто – датчиками, системой питания, системой зажигания.

Здесь следует отметить, что проблемы с системами питания и зажигания могут как раз и стать причиной выхода катализатора из строя.

Некачественное топливо, неправильное смесеобразование, пропуски зажигания приведут к тому, что топливо не полностью будет сгорать, из-за чего в выхлопных газах будет значительное количество сажи.

И как итог – быстрое забивание бобин с возможным последующим оплавлением.

Что касается иномарок, к примеру, форд Фокус, то признаки забитого элемента полностью идентичны автомобилям ВАЗ.

Вся та же потеря мощности, нестабильная работа силовой установки, возможет шум внутри корпуса.

К чему может привести поврежденный катализатор

Если каталитический нейтрализатор только забит сажей, то его еще можно прочистить. Но если не обращать внимания на возникшую проблему, то в лучшем случае автомобиль попросту однажды не сможет завестись, или же мотор запустится, но быстро заглохнет.

Хуже, если из-за сажи произошло оплавление бобины. Восстановить поврежденный элемент не получится, тогда вернуть работоспособность двигателю поможет либо замена каталитического нейтрализатора, либо удаление его и установка пламегасителя.

Самым худшим вариантов является механическое разрушение. Частицы сотов могут значительно осложнить прохождение выхлопных газов по катализатору.

Из-за этого часть газов может вернуться обратно в цилиндры, да еще и с примесями керамики.

А сторонние предметы в цилиндрах, пусть и мелкие могут привести уже к повреждению цилиндропоршневой группы и надобности в капитальном ремонте.

Но не стоит всегда «грешить» на катализатор, он может быть лишь последствием того, что какая-то из систем авто работает неправильно, или в машину заливается некачественное топливо с большим количеством присадок.

Поэтому даже при малейшем падении мощности следует сразу же провести диагностику состояния систем питания и зажигания, а также оценить работоспособность всех датчиков, а уже после проверять катализатор.

Признаки забитого или разрушенного катализатора машины. Методы диагностирования неисправностей катализатора

Мы уже говорили ранее о катализаторе (каталитический нейтрализатор) и его работе, теперь разберемся с симптомами неисправности. Любой неопытный водитель без проблем определит неисправность в выхлопной трубе, зачастую связанную с нейтрализатором. Сигналы неисправности будут идентичными как для отечественных автомобилей марки ВАЗ, так и иномарках будь то Ford, Toyota или другая марка.

 

Признаки неисправности забитого или разрушенного катализатора

  • Автомобиль не заводится или моментально глохнет. Говорит о полной поломке нейтрализатор.
    Решение: Выкрутить датчик кислорода (стоит перед катализатором). Завести двигатель, если автомобиль заработал — значит боченок катализатора неисправен, требуется замена на новый или аналог (пламегаситель).
  • Автомобиль плохо разгоняется и двигатель медленно набирает обороты. При движении создается впечатление что машину удерживают сзади. Значит соты забиты частично.
  • Увеличился расход топлива. Тоже симптом неполадок катализатора, но не обязательный, может указывать и на другую неисправность, например топливных форсунок.
  • Выхлопы слабо выходят из трубы – соты забиты.
  • Выхлопы имеют сизый оттенок и едкий, неприятный запах – катализатор разрушен или оплавлен.
  • При перегазовке или разгоне слышится металлический звук (как будто щебенки насыпали) — катализатор наполовину разрушен, забит блок, или возможно бочек катализатора сдвинулся с назначенного места.
  • Загорелся индикатор «Check Engine», низкая эффективность (ошибка P0420). Может возникнуть при других проблемах, но и сигнализирует о возможной неисправности нейтрализатора.

%rtb-4%

Как диагностировать неисправность катализатора

Удостовериться в работоспособность каталитического нейтрализатора можно самостоятельно. На крайний случай, автосервисы делают платную диагностику. Выделим 3 основных метода проверки каталитического нейтрализатора.

  1. Визуальный

    При деформации корпуса, велика вероятность повреждения сот катализатора. В таком случае наружный осмотр не даст понимания о загрязненности, потребуется снятие детали с машины. Проблема заключается в очень сложном снятии данной детали, не редко фиксаторы «прикипают», в таком случае их приходится срезать болгаркой.
    Сняв нейтрализатор, внимательно осматривают на просветы. Если соты забиты грязью, их чистят или меняют на новый.
    Но не всегда конструкция позволяет провести внутренний осмотр без вскрытия корпуса катализатора.

  2. Противодавление

    Популярный метод, демонтаж не требуется. Используется манометр и трубка-переходник для него. Манометр устанавливают вместо кислородного датчика (лямбда-зонда). Важно создать полностью герметичное соединение. Завести двигатель, поднять обороты до 2,5-3 тысяч, поддерживать их 10-15 секунд для фиксации показания манометра. Полученные данные сравнить с нормой. У всех моделей норма разная, но можно и ориентироваться на усредненные:
    · 0,3 кгс/см2 – норма;
    · 0,35 кгс/см2 – норма для доработанных двигателей, иначе повышенный;
    · 0,5 кгс/см2 и выше – проблема с нейтрализатором.

  3. Диагностика мотор-тестером

    Мотор-тестер — комплект оборудования, помогающий определить состояние машины на основе осциллограмм. Подключается вместо свечи зажигания, при старте двигателя снимаются данные, на основе которых делают выводы неисправностях автомобиля.

Последствия эксплуатации автомобиля с разрушенным или забитым катализатором

Забитый сажей нейтрализатор можно прочистить. Но, стоит упустить этот момент и в лучшем случае автомобиль однажды не заведется или сразу заглохнет. Куда хуже, если бобина оплавится, восстановление детали будет невозможно. Куда хуже – механическое разрушение катализатора, велика вероятность попадания керамики в цилиндры, приводящее к капитальному ремонту двигателя.
Устранив своевременно неисправность каталитического нейтрализатора, можно избежать сложного и дорогостоящего ремонта, а так же снизить расход топлива.

Что такое катализатор в автомобиле?

Для чего нужен лямбда-зонд в автомобиле

Как определить, не забит ли катализатор: знаки

Выхлопная система — неотъемлемая часть каждого автомобиля. С годами его будут улучшать, и теперь почти все автомобили снабжены катализатором. Что это за элемент и как определить, не забит ли катализатор? Симптомы неисправности и устройство элемента описаны далее в этой статье.

Назначение

Полное наименование элемента — катализатор. Он служит для снижения уровня выбросов в атмосферу вредных веществ, которые попадают туда с выхлопными газами.

Где используется?

Данный элемент применяется на всех дизельных и бензиновых двигателях с нормой «Евро-3» и выше. Каталитический нейтрализатор устанавливается сразу после впускной трубы — за выпускным коллектором.

Устройство

Элемент состоит из нескольких частей. Это корпус, несущий элемент и теплоизоляция. Второй — главный элемент этой «цепочки». Изготовлен блок из специальной керамики, которая не боится высоких температур.По своей конструкции эта деталь представляет собой набор ячеек.

Значительно увеличивают площадь контакта керамического «сердечника» с выхлопными газами. На поверхности этих клеток есть особые вещества (катализаторы). Это палладий, платина и родий. Эти элементы ускоряют время химических реакций. Палладий и платина относятся к ряду окислительных катализаторов. Благодаря им углеводороды, содержащиеся в газах, превращаются в водяной пар; оксиды окиси углерода — в двуокись углерода.Родий — восстанавливающий элемент. Он превращает оксид азота в безвредный азот. Вместе все три химических элемента снижают уровень вредных веществ в выхлопных газах.

Конструктивно носитель размещен в металлическом корпусе. Между этими двумя элементами находится слой теплоизоляции. Внутри нейтрализатора также находится кислородный датчик. Главное условие каталитического нейтрализатора — высокая температура газов (около 300 градусов). При нагревании до такого уровня родий, палладий и платина могут задерживать до 90 процентов вредных веществ, которые могут попасть в атмосферу.

Как определить неисправность?

Какие признаки засорения катализатора? Выявить неисправность этого элемента можно по нескольким признакам:

  • Машину стало трудно заводить.
  • При движении появляются провалы, которые иногда исчезают.
  • Горит лампочка «Проверьте двигатель».

Причины плохой динамики разгона объясняются низкой пропускной способностью катализатора.

Иногда бывает, что машина легко набирает скорость на 150 км / ч и потом, останавливаясь, еле разгоняется до 60.В результате резко снижается производительность двигателя (низкий уровень вентиляции цилиндров). Двигатель не может захватить новую порцию воздуха, так как выхлопные газы не могут нормально выйти из системы — они «застревают» в камере сгорания.

Почему это происходит?

Если у вас засорился катализатор, признаки (дизель это или бензин — не беда), его неисправность может заключаться в большом количестве дымовых газов. В них содержится определенный процент масла (это естественно), но когда двигатель «съедает» литр за тысячу километров, оно начинает оставаться на ячейках нейтрализатора.Также признаком засорения катализатора является малый диаметр трансмиссионных ячеек. Из-за высокой концентрации смол и примесей в топливе они легко забиваются в этом элементе.

Обратите внимание, что некачественное топливо играет важную роль в ресурсе катализатора. При частом использовании плохое топливо оседает в выпускном коллекторе, прежде чем полностью сгорит в камере. Это может вызвать перегрев деталей катализатора. Немаловажную роль играют механические повреждения. Малейший удар по неровности (тот же лежащий полицейский) вызовет деформацию элемента, из-за чего он не будет работать должным образом.Отколовшаяся в полости катализатора мелкая крошка легко забивает мелкие соты. Таким образом, основные признаки засорения катализатора (ВАЗ-2172 не исключение) связаны с неспособностью системы нормально «выпускать» выхлопные газы, из-за чего они застаиваются во впускной трубе и цилиндрах. Это провоцирует большую потерю мощности и повышенный расход топлива.

Что делать, если катализатор забился? Приметы и диагностика элемента своими руками

Проверить это можно тремя способами.Первый — самый эффективный.

Это проверка катализатора при его демонтаже. Устраняется очень просто. Для демонтажа необходимо взять два накидных или карабинных ключа на 13. С одной стороны закрепляем болт, а с другой стороны вращаем гайку против часовой стрелки. Однако могут возникнуть трудности. Поскольку нейтрализатор находится под днищем (не самое чистое место в машине), его элементы крепления могут просто заржаветь.

И стандартный WD 40 тут не помогает.Поэтому в половине случаев приходится брать болгарку в руки и срезать болты. Но это еще не все. Поскольку нейтрализатор является частью выхлопной системы, он работает при повышенных температурах. Соответственно, его части (одна идет от приемной трубы, вторая — к резонатору) просто прилипают к соседнему металлу. В этом случае спасаются только молотки. Но это не лучшее решение. Как мы уже говорили ранее, от малейших ударов внутренняя часть просто деформируется. Нарезка других элементов болгарки для удаления катализатора — тоже не вариант.Следовательно, оказывается, что убрать этот элемент наружу не так-то просто. Что ж, если катализатор не застрял, при его успешном демонтаже внимательно осматриваем на предмет засорения — между сеткой должен быть сквозной зазор.

Второй способ

Этот метод диагностики проводится без механических вмешательств — катализатор остается на своем месте. Метод предполагает измерение давления в системе. Для этого на место кислородного датчика ввинчивается манометр (иногда требуется переходник) и измеряются показания при разных оборотах двигателя.

На 2,5 тыс. Нормальный уровень — 0,3 кгс / см 3 . Если значение меньше допустимого, газы не в том состоянии, в котором они могут выходить наружу. Из-за этого машина теряет мощность. Также диагностику можно проводить с помощью мотор-тестера (самый технологичный метод на сегодняшний день). В цилиндр вместо свечи зажигания ввинчивается датчик давления. Затем при разных оборотах коленчатого вала анализируется осциллограмма. Естественно, все это требует наличия оборудования, поэтому первый способ более привычен нашим автовладельцам.

Удалить предмет

Если у вас засорился катализатор (учтены признаки неисправности), его необходимо заменить на новый.

Однако есть проблема — средняя стоимость новых нейтрализаторов составляет порядка 100 долларов. Поэтому автолюбители просто вынимают его из системы, устанавливая на его место пламегаситель или распорку в виде обычной трубы. Однако после таких действий необходимо удалить катализатор с блока ЭБУ (мозги автомобиля). Считается, что это действие увеличит мощность и реакцию дроссельной заслонки автомобиля на 5 процентов (за счет лучшей вентиляции выхлопных газов).

Итак, мы разобрались, почему засоряется катализатор, признаки неисправности и способы устранения.

.

Как определить признаки засорения катализатора

Каталитический нейтрализатор — это неотъемлемая часть системы контроля выбросов в вашем автомобиле, которая отвечает за управление загрязнением и минимизацию вашего углеродного следа в мире. Он работает, преобразовывая выбросы вредных газов в безопасные соединения, тем самым нанося минимальный ущерб окружающей среде. Он расположен в нижней части автомобиля, между глушителем выхлопа и двигателем. Каталитический нейтрализатор рассчитан на весь срок службы вашего автомобиля, и он редко выходит из строя.Но иногда он забивается и ухудшает свою работу. Он подвергается сильным ударам из-за внутренних повреждений двигателя, а также посторонних предметов. Итак, если вы подозреваете, что в вашем автомобиле неисправен катализатор, убедитесь, что вы можете определить признаков засорения катализатора , упомянутых в этой статье oneHOWTO .

Ухудшение работы двигателя

Если ваш каталитический нейтрализатор засорится, вы заметите значительное снижение производительности вашего двигателя на .За это отвечает противодавление, влияющее на работу вашего двигателя, поскольку оно мешает двигателю дышать и работать на оптимальном уровне. Поскольку противодавление внезапно увеличивается, ваш двигатель может заглохнуть во время движения. В большинстве случаев вы будете чувствовать, что в вашей системе есть воздушная пробка. Ваш автомобиль может дергаться, и вам может показаться, что в нем мало топлива. Треснувший катализатор вызовет утечку в вашем двигателе, а забитый приведет к ограничению потока выхлопных газов. В обоих случаях вы заметите ухудшение характеристик вашего двигателя, ускорения и пробега.

Уменьшенный пробег

Если в вашем автомобиле забит катализатор, вы заметите, что значительно снизилась в топливной экономичности . Со временем это будет вам дорого стоить. Итак, если вы подозреваете, что катализатор забит, начните замечать, сколько километров пробегает ваша машина на литре топлива.

Пар топлива

Если в вашей машине есть карбюратор, проверьте катализатор, чтобы проверить наличие паров топлива. . Для этого снимите воздушный фильтр с автомобиля и посмотрите на карбюратор автомобиля.Увеличьте обороты двигателя и проверьте, нет ли на нем каких-либо признаков паров топлива, которые в конечном итоге могут вызвать закупорку паров топлива. Если да, то это признак засорения катализатора в вашей машине, и вам необходимо его почистить или заменить.

Проблема с выхлопной системой

Если вы заметили темный или черный выхлопной дым из выхлопной системы или глушителя, это может быть серьезным признаком накопления углерода внутри двигателя из-за забитого катализатора. Если вы регулярно обслуживаете свой автомобиль и используете только высококачественные присадки к бензину и неэтилированный бензин, то велика вероятность, что виновником является только засоренный катализатор, который может нуждаться в очистке или замене.

Дребезжащие звуки

Дребезжащий звук — еще один признак засорения катализатора в вашей машине. Если ваш катализатор станет поврежденным или старым изнутри из-за богатой смеси топлива, сотовая сетка внутри катализатора разобьется или разрушится, из-за чего вы можете услышать дребезжащий звук во время движения . Вы сразу услышите этот звук, когда заведете машину, и со временем он будет ухудшаться.

Убедитесь, что свет двигателя включен

Включенный индикатор проверки двигателя также может быть признаком засорения катализатора в вашем автомобиле.Прочтите нашу статью Почему горит индикатор двигателя моего автомобиля , чтобы узнать больше. Современные автомобили оснащены датчиками воздушно-топливного и кислородного состава, которые используются для контроля уровня газа в выхлопе, тем самым проверяя эффективность катализатора. Если катализатор не работает должным образом или если катализатор не катализирует выхлопные газы автомобиля, вы увидите, что загорелся индикатор проверки двигателя. Это сделано для того, чтобы предупредить водителя о наличии проблемы.

Используйте свое обоняние

Забитый катализатор часто будет ужасно пахнуть запахом, который очень похож на комбинацию серы и тухлых яиц .Водитель и пассажиры не замечают такого запаха, и он служит верным признаком очистки или замены катализатора.

Если вы хотите прочитать статьи, похожие на Как определить симптомы засорения катализатора , мы рекомендуем вам посетить нашу категорию «Техническое обслуживание и ремонт автомобилей».

.

Каковы общие проблемы с каталитическим нейтрализатором? | Новости

Каталитический нейтрализатор

Cars.com Изображение Эвана Сирса

Каталитические нейтрализаторы расположены в выхлопной системе между двигателем и глушителем и являются одной из последних линий защиты от загрязнения воздуха транспортными средствами.Они используют шарики с керамической кодировкой и различные драгоценные металлы (катализаторы) для преобразования таких загрязнителей, как несгоревший газ и оксид азота, в безвредные газы.

Связано: Каталитический нейтрализатор: что вам нужно знать

Каковы возможные проблемы с каталитическим нейтрализатором?

Каталитические нейтрализаторы

часто служат 10 и более лет, но они могут быть загрязнены, забиты, перегреты или физически повреждены, что приведет к снижению производительности двигателя и, в конечном итоге, к остановке двигателя.

Одним из потенциальных загрязнителей является этилированный газ, который может разрушить катализаторы, хотя он редко встречается в США. Другие загрязнители включают охлаждающую жидкость двигателя, которая может просачиваться в систему сгорания из-за неисправной прокладки головки блока цилиндров, и моторное масло. Эти жидкости могут засорить каталитический нейтрализатор, что затруднит прохождение выхлопных газов. Автомобильные двигатели похожи на спортсменов тем, что им требуется много кислорода. Если поток выхлопных газов ограничен, это означает, что в двигатель может попасть меньше воздуха и ухудшаются характеристики.Если двигатель вяло реагирует или останавливается после некоторой работы, это может быть причиной засорения преобразователя.

Каталитические нейтрализаторы

могут перегреться из-за чрезмерного количества несгоревшего газа, вызванного пропуском зажигания в свече зажигания или негерметичным выпускным клапаном. Кроме того, вышедший из строя датчик кислорода может вызвать перегрев.

На многих транспортных средствах «кошка» расположена под транспортным средством, и, как и другие части выхлопной системы, она также может быть повреждена дорожным мусором или наездом на бордюр.

Кража каталитического нейтрализатора

Те драгоценные металлы, о которых мы говорили, могут привлечь внимание: Каталитические преобразователи часто крадут из-за драгоценных металлов внутри. В переработчиках есть небольшие количества платины, родия и палладия, и все они имеют ценность для торговцев металлами.

Техническое обслуживание каталитического нейтрализатора

Среди симптомов неисправного каталитического нейтрализатора:

  • Низкая работа двигателя
  • Пониженное ускорение
  • Темный дым выхлопных газов
  • Запах серы или тухлых яиц из выхлопа
  • Перегрев под автомобилем

Некоторые из этих симптомов также могут быть вызваны другими частями системы выпуска отработавших газов, поэтому механику важно определить, когда пора заменить каталитический нейтрализатор.

Следование рекомендованному графику технического обслуживания вашего автомобиля может помочь отсрочить этот момент как можно дольше — часто на 10 лет и более. Поддержание систем выхлопа, выхлопа и сгорания в хорошем состоянии сведет к минимуму риск выхода из строя каталитического нейтрализатора раньше срока.

Наконец, не игнорируйте индикатор проверки двигателя. Повреждение каталитического нейтрализатора — одна из причин, по которой Cars.com входит в десятку крупнейших преступлений, связанных с обслуживанием автомобилей. Это может быть предупреждением о засорении воздушного или топливного фильтра.Ожидание замены этого фильтра может привести к преждевременной замене каталитического нейтрализатора за 1000 долларов.

Ещё на Cars.com:

Редакционный отдел Cars.com — ваш источник автомобильных новостей и обзоров. В соответствии с давней политикой этики Cars.com редакторы и рецензенты не принимают подарки или бесплатные поездки от автопроизводителей. Редакционный отдел не зависит от отделов рекламы, продаж и спонсируемого контента Cars.com.

доля

Автор сообщения Рик Поупли десятилетиями освещал автомобильную промышленность и ведет еженедельное онлайн-радио-шоу на TalkZone.com. Написать Рику .

6 Признаков плохого каталитического нейтрализатора и стоимость его замены (это не дешево)

Последнее обновление 31 августа 2020 г.

Каталитические нейтрализаторы (не преобразователи кадиллака, как некоторые любят говорить) помогают удалять окись углерода (и другие токсичные газы), которые Автомобиль производит поступающий снаружи воздух, которым мы дышим. Хотя вполне вероятно, что вам никогда не придется ремонтировать или заменять свои, иногда они выходят из строя.

Ищете хорошее онлайн-руководство по ремонту? Щелкните здесь, чтобы увидеть 5 лучших вариантов.

Итак, каковы симптомы плохого каталитического нейтрализатора? Можно ли отремонтировать каталитический нейтрализатор? А во сколько обойдется замена каталитического нейтрализатора?

Продолжайте читать, чтобы получить общее представление о каталитических нейтрализаторах, узнать, какие признаки искать у неисправного кота и какие у вас есть варианты по устранению проблемы.

Что такое каталитический нейтрализатор?

Каталитический нейтрализатор, также известный как «кот», является частью выхлопной системы. Он расположен между выпускным коллектором и глушителем.

Большинство автомобилей на сегодняшний день имеют один каталитический нейтрализатор, но многие автомобили с двойным выхлопом имеют два (по одному на каждый комплект труб). Некоторые автомобили более высокого класса теперь имеют двух рядных котлов, что дополнительно снижает вредные выбросы газов.

Его задача — отфильтровать или «преобразовать» вредные газы (оксид азота, монооксид углерода и несгоревшие углеводороды), которые производит автомобиль, прежде чем они попадут в атмосферу. Эти ядовитые газы почти в одиночку положили конец эре классических маслкаров в 70-х годах и ответственны за большую часть смога в крупных городах.

Как работает каталитический нейтрализатор?

После запуска автомобиля токсичные газы, вырабатываемые двигателем автомобиля, проходят через каталитический нейтрализатор. Внутренняя структура кота представляет собой сотовую структуру из драгоценных металлов, таких как платина, палладий и родий.

При высокой температуре, на которую рассчитан каталитический нейтрализатор (около 800 градусов F), происходит химическая реакция, в результате которой из глушителя выходят более безопасные элементы, такие как кислород, вода и углекислый газ.

Что вызывает выход из строя каталитического нейтрализатора?

Как упоминалось ранее, большинство каталитических нейтрализаторов прослужат весь срок службы автомобиля. Но в некоторых случаях кошка испортится и ее нужно будет заменить.

Почти все проблемы с каталитическим нейтрализатором возникают из-за неисправности двигателя. Чаще всего это вызвано избытком топлива, попадающим в выхлопную систему из-за неправильной топливно-воздушной смеси, неисправных свечей зажигания, неправильной синхронизации двигателя, неисправного датчика кислорода или других проблем, когда топливо выходит из камеры сгорания двигателя несгоревшим.

Когда это происходит, каталитический нейтрализатор достигает слишком высокой температуры и фактически начинает плавить внутренности кота или разрушать сотовый материал. Результат — нефункционирующая кошка.

Кроме того, вышедшие из строя прокладки, плохие уплотнения клапанов или изношенные поршневые кольца могут привести к попаданию масла или антифриза в систему выпуска отработавших газов и покрытию керамического катализатора внутри преобразователя густой углеродной сажей.

Если это будет продолжаться достаточно долго, эти углеродные отложения забьют каталитический нейтрализатор, и он не сможет выполнять свою работу.В худшем случае поток выхлопных газов полностью блокируется, и в двигателе создается противодавление, что может вызвать перегрев и другие проблемы.

Наконец, кошке могут быть нанесены физические повреждения. Хотя это и не является обычным явлением, камни, дорожный мусор или выбоины могут повредить или расколоть внешнюю оболочку кошки или поддерживающие ее вешалки.

Каталитический нейтрализатор с вмятинами часто означает, что части хрупкого керамического катализатора отломились внутри и функциональность каталитического нейтрализатора ухудшается.

Признаки неисправности каталитического нейтрализатора

Вот 6 общих симптомов, позволяющих узнать, что ваш каталитический нейтрализатор засорен или неисправен.

№ 1 — Запах тухлого яйца из выхлопных газов

Если вы чувствуете запах тухлых яиц, это явный признак неисправности каталитического нейтрализатора. Бензин содержит небольшое количество серы, которая в процессе сгорания превращается в сероводород.

Каталитический нейтрализатор, который работает должным образом, преобразует сульфид с запахом в диоксид серы без запаха. Когда кошка плохая, конверсия не происходит, поэтому часть несгоревших газов, содержащих вонючий сероводород, выходит из выхлопных газов.

# 2 — «Проверьте двигатель» горит

Если каталитический нейтрализатор вашего автомобиля вышел из строя или вышел из строя, на приборной панели загорится индикатор «Проверьте двигатель». Современные автомобили содержат кислородные датчики, которые могут контролировать эффективность каталитического нейтрализатора, проверяя уровни выхлопных газов.

Если эти датчики обнаруживают, что выхлопные газы не катализируются должным образом по какой-либо причине, загорится индикатор проверки двигателя. Тогда водитель будет знать, что что-то не так, хотя он не будет точно знать, в чем проблема, потому что свет может означать много разных вещей.

Лучше всего получить коды неисправностей из автомобиля с помощью диагностического сканирующего прибора. P0420 и P0430 — два общих кода неисправности, которые указывают на отказ каталитического нейтрализатора.

# 3 — Плохое ускорение

Одним из наиболее распространенных симптомов засорения каталитического нейтрализатора является недостаток мощности двигателя, особенно когда вы пытаетесь разогнаться, например, когда вам нужно быстро обогнать другой автомобиль.

Когда накопление углерода внутри сотовой конструкции становится слишком большим или когда внутренние детали начинают плавиться из-за избыточного тепла от несгоревшего топлива, происходит частичная блокировка внутри каталитического нейтрализатора.

Ваш двигатель зависит от хорошего потока выхлопных газов для работы на пиковой мощности. Когда поток ограничен из-за забитого преобразователя, вы заметите нехватку мощности при ускорении, подъеме в гору или буксировке тяжелого груза.

В случаях засорения из-за отложений нагара очистка каталитического нейтрализатора может помочь удалить засорение.

# 4 — Неудачный тест на выбросы

В большинстве регионов США каждые несколько лет требуется, чтобы ваш автомобиль проходил тест на смог, чтобы убедиться, что он правильно сжигает топливо и не выбрасывает опасные газы в атмосферу.Одна из наиболее частых причин неудачного теста на выбросы — плохой каталитический нейтрализатор.

В зависимости от вашего автомобиля, диагностика будет проводиться либо через порт OBD2 на вашем автомобиле (автомобили 1996 года выпуска или новее), либо через шланг, подключенный к концу выхлопной трубы, который напрямую измеряет уровни токсичных газов (автомобили, выпущенные до 1996 года. ).

# 5 — Дребезжащий шум

Если части сотового материала внутри каталитического нейтрализатора разорвутся из-за чрезмерного нагрева или повреждения, вы, скорее всего, заметите дребезжащий звук, исходящий из-под вашего автомобиля во время холостого хода или движения.При запуске двигателя шум часто бывает самым громким.

Вы захотите заменить кошку как можно скорее, так как эти куски выбитого материала действительно могут попасть дальше по выхлопной системе и в глушитель. Эта блокировка может затем привести к остановке автомобиля и даже помешать вам снова завести автомобиль.

# 6 — Пониженная экономия топлива

Когда у вас заблокирован каталитический нейтрализатор, более низкий воздушный поток может привести к тому, что ваш автомобиль сожжет больше топлива, чем необходимо.В связи с указанным выше признаком плохого ускорения, когда у вас нет надлежащего потока выхлопных газов, вы вынуждены чаще нажимать на педаль газа, поскольку это влияет на ускорение.

Это соответствует тому, что двигатель впрыскивает больше топлива в цилиндры, что приводит к тому, что топливная смесь в автомобиле намного богаче, чем необходимо.

Поскольку уменьшение расхода бензина является признаком многих других проблем, само по себе это не означает, что вам нужно заменить каталитический нейтрализатор. Но в сочетании с одним из вышеперечисленных признаков это может быть хорошим показателем.

Стоимость замены каталитического нейтрализатора

Из-за драгоценных металлов, используемых в его конструкции (например, платины и палладия), замена каталитического нейтрализатора стоит недешево. Следует учитывать возраст и марку автомобиля, количество каталитических нейтрализаторов в автомобиле и то, является ли эта модель запчастью OEM или запасной частью.

Бензиновые двигатели — 1981 г. и новее

Почти все автомобили с бензиновыми двигателями, выпускаемые с 1981 г., имеют трехкомпонентный каталитический нейтрализатор.Эта конструкция более сложная, чем у старых автомобилей, что означает, что стоимость деталей также высока.

В среднем ожидайте заплатить где-то от 500 до 2200 долларов за замену каталитического нейтрализатора в новых автомобилях. Только запчасти будут стоить от 400 до 2000 долларов. Затраты на рабочую силу обойдутся вам в 75–150 долларов за расчетный час работы, необходимой для замены.

Бензиновые двигатели — до 1981 г. (и дизельные двигатели)

Автомобили с бензиновыми двигателями, построенные до 1981 г., и большинство дизельных двигателей (в любой год) имеют двухкомпонентные каталитические нейтрализаторы.Поскольку конструкция довольно проста, затраты на замену обычно ниже.

Общая стоимость замены каталитического нейтрализатора в этих старых автомобилях составит от 175 до 750 долларов . Вы будете платить от 100 до 600 долларов за запчасти и еще от 75 до 150 долларов за труд. Имейте в виду, что чем старше или реже автомобиль, тем дороже новый кот из-за дефицита.

Можно ли отремонтировать каталитический нейтрализатор?

Это зависит. Если вы считаете, что у вас просто грязный или забитый каталитический нейтрализатор, добавление очистителя каталитического нейтрализатора в газ может помочь устранить засорение.Это может занять более одного раза. Альтернативный и очень надежный метод очистки каталитического нейтрализатора — вынуть кошку и замочить ее в растворе лимонной кислоты на 6-8 часов.

Другой вариант — использовать гидроксид натрия. Вот хорошее видео, объясняющее процесс:

Если есть повреждение каталитического нейтрализатора, в том числе фрагменты сотовой части, отколовшиеся внутри, просто не стоит пытаться любой тип ремонта, даже если вы найдете людей в Интернете. говоря иначе.В таких случаях замена — действительно ваш единственный выход.

Как предотвратить засорение

Если вы регулярно путешествуете на автомобиле на короткие расстояния, углеводороды могут сгореть не полностью, потому что каталитический нейтрализатор не имеет возможности достаточно нагреться. Чтобы снизить вероятность засорения каталитического нейтрализатора, время от времени старайтесь водить автомобиль по шоссе примерно 10–15 минут.

Это создаст необходимое тепло внутри кошки, чтобы эффективно сжечь эти углеводородные отложения, чтобы ваша кошка бегала максимально эффективно.

.Справочник команд

, Cisco IOS XE Gibraltar 16.10.x (коммутаторы Catalyst 9200) — диспетчер стека и команды высокой доступности [коммутаторы Cisco Catalyst серии 9200]

Для отображения информацию об объекте резервирования, используйте команда show redundancy в привилегированном режиме EXEC

показать резервирование [клиенты | config-sync | счетчики | история [перезагрузить | обратный] | рабы [ slave-name ] {клиенты | счетчики} | государства | переключение история [домен по умолчанию]]

Описание синтаксиса

клиенты

(необязательно) Отображает информацию о клиенте средства резервирования.

config-sync

(Необязательно) Отображает сбой синхронизации конфигурации или игнорируемый список несовпадающих команд.Для дополнительной информации, см. show redundancy config-sync.

счетчики

(необязательно) Отображает информацию о счетчике средств резервирования.

история

(необязательно) Отображает журнал прошлого статуса и соответствующую информацию для резервирования объект.

перезагрузка истории

(необязательно) Отображает журнал информации о прошлой перезагрузке для средства резервирования.

история вспять

(необязательно) Отображает обратный журнал прошлого статуса и связанную информацию для средство резервирования.

рабы

(Необязательно) Отображает всех подчиненных в средстве резервирования.

ведомое имя

(Необязательно) Имя подчиненного средства резервирования, для которого отображается конкретная информация.Введите дополнительные ключевые слова для отображения всех клиентов или счетчиков в указанном подчиненном.

клиента

Отображает всех клиентов средства резервирования в указанных подчиненных.

счетчиков

Отображает все счетчики в указанном подчиненном.

состояния

(необязательно) Отображает информацию о состоянии средства резервирования, например отключено, инициализация, режим ожидания или активный.

история переключения

(необязательно) Отображает информацию об истории переключения средств резервирования.

домен по умолчанию

(необязательно) Отображает домен по умолчанию как домен, для которого отображается история переключений.

Команда По умолчанию

Нет

Командные режимы

Привилегированный EXEC (#)

История команд

Выпуск Модификация

Cisco IOS XE Fuji 16.9.2

Эта команда была представлена.

Примеры

Этот пример показывает как отобразить информацию об объекте резервирования:

  Устройство №   показать избыточность   Информация о резервной системе: ------------------------------ Доступное время безотказной работы системы = 1 час 25 минут Испытанная система переключений = 0 Сбои в режиме ожидания = 0 Причина последнего переключения = не известна Аппаратный режим = дуплекс Настроенный режим резервирования = SSO Рабочий режим резервирования = SSO Режим обслуживания = отключен Связь = Вверх Текущая информация о процессоре: ------------------------------ Активное местоположение = слот 1 Текущее состояние программного обеспечения = АКТИВНО Время работы в текущем состоянии = 1 час 25 минут Версия образа = ПО Cisco IOS, ПО коммутатора Catalyst L3 (CAT9K_LITE_IOSXE), версия 16.9.x Авторское право (c) 1986-2018, Cisco Systems, Inc. Составлено сб 29-S Регистр конфигурации = 0x102 Информация о одноранговом процессоре: ---------------------------- Место ожидания = слот 3 Текущее состояние программного обеспечения = STANDBY HOT Время работы в текущем состоянии = 1 час 22 минуты Версия образа = ПО Cisco IOS, ПО коммутатора Catalyst L3 (CAT9K_LITE_IOSXE), Версия 16.9.x Авторское право (c) 1986-2018, Cisco Systems, Inc. Составлено сб 29-S Регистр конфигурации = 0x102 Номер устройства  

Этот пример показывает как отобразить информацию о клиенте объекта резервирования:

  Устройство №   показать клиентов резервирования   ID группы = 1 clientID = 20002 clientSeq = 4 Клиент EICORE HA clientID = 24100 clientSeq = 5 WCM_CAPWAP clientID = 24101 clientSeq = 6 WCM RRM HA clientID = 24103 clientSeq = 8 WCM QOS HA clientID = 24105 clientSeq = 10 WCM_MOBILITY clientID = 24106 clientSeq = 11 WCM_DOT1X clientID = 24107 clientSeq = 12 WCM_APFROGUE clientID = 24110 clientSeq = 15 WCM_CIDS clientID = 24111 clientSeq = 16 WCM_NETFLOW clientID = 24112 clientSeq = 17 WCM_MCAST clientID = 24120 clientSeq = 18 wcm_comet clientID = 24001 clientSeq = 21 Клиент диспетчера таблиц clientID = 20010 clientSeq = 24 SNMP SA HA Клиент clientID = 20007 clientSeq = 27 Установщик HA Client clientID = 29 clientSeq = 60 Режим резервирования RF clientID = 139 clientSeq = 61 IfIndex clientID = 3300 clientSeq = 62 Постоянная переменная clientID = 25 clientSeq = 68 CHKPT RF clientID = 20005 clientSeq = 74 IIF-прокладка clientID = 10001 clientSeq = 82 Платформа QEMU RF   

На выходе отображается Следующая информация:

  • clientID отображает идентификационный номер клиента.

  • clientSeq отображает порядковый номер уведомления клиента.

  • Текущий состояние устройства резервирования.

В этом примере показано как отобразить информацию счетчика средства резервирования:

  Устройство №   показать счетчики избыточности   OM объекта резервирования связь вверх = 0 связь отключена = 0 неверный клиент tx = 0 null tx от клиента = 0 tx отказов = 0 tx длина сообщения недопустима = 0 клиент не принимает сообщения = 0 rx peer msg routing errors = 0 NULL peer msg rx = 0 сообщение об ошибке равноправного узла rx = 0 буферы tx = 0 tx буферы недоступны = 0 буферы rx = 0 ошибки освобождения буфера = 0 повторяющиеся регистры клиентов = 0 не удалось зарегистрировать client = 0 Недействительные клиентские синхронизации = 0 Номер устройства  

Этот пример показывает как отобразить информацию истории объекта резервирования:

  Устройство №   показать историю резервирования   00:00:00 * мое состояние = ИНИЦИАЛИЗАЦИЯ (2) одноранговое состояние = ОТКЛЮЧЕНО (1) 00:00:00 RF_EVENT_INITIALIZATION (524) op = 0 rc = 0 00:00:00 * мое состояние = ПЕРЕГОВОРЫ (3) одноранговое состояние = ОТКЛЮЧЕНО (1) 00:00:01 добавлен клиент: Клиент диспетчера таблиц (24001) seq = 21 00:00:01 добавлен клиент: SNMP SA HA Client (20010) seq = 24 00:00:06 добавлен клиент: WCM_CAPWAP (24100) seq = 5 00:00:06 добавлен клиент: WCM QOS HA (24103) seq = 8 00:00:07 добавлен клиент: WCM_DOT1X (24106) seq = 11 00:00:07 добавлен клиент: EICORE HA Client (20002) seq = 4 00:00:09 добавлен клиент: WCM_MOBILITY (24105) seq = 10 00:00:09 добавлен клиент: WCM_NETFLOW (24111) seq = 16 00:00:09 добавлен клиент: WCM_APFROGUE (24107) seq = 12 00:00:09 добавлен клиент: WCM RRM HA (24101) seq = 6 00:00:09 добавлен клиент: WCM_MCAST (24112) seq = 17 00:00:09 добавлен клиент: WCM_CIDS (24110) seq = 15 00:00:09 добавлен клиент: wcm_comet (24120) seq = 18 00:00:22 RF_STATUS_REDUNDANCY_MODE_CHANGE (405) Первый подчиненный (0) op = 0 rc = 0 00:00:22 RF_STATUS_REDUNDANCY_MODE_CHANGE (405) Ведомый (6107) op = 0 rc = 0 00:00:22 RF_STATUS_REDUNDANCY_MODE_CHANGE (405) Ведомый (6109) op = 0 rc = 0 00:00:22 RF_STATUS_REDUNDANCY_MODE_CHANGE (405) Ведомый (6128) op = 0 rc = 0 00:00:22 RF_STATUS_REDUNDANCY_MODE_CHANGE (405) Ведомый (8897) op = 0 rc = 0 00:00:22 RF_STATUS_REDUNDANCY_MODE_CHANGE (405) Ведомый (8898) op = 0 rc = 0 00:00:22 RF_STATUS_REDUNDANCY_MODE_CHANGE (405) Ведомый (8901) op = 0 rc = 0 00:00:22 RF_EVENT_SLAVE_STATUS_DONE (523) Первый подчиненный (0) op = 405 rc = 0 00:00:22 RF_STATUS_REDUNDANCY_MODE_CHANGE (405) Режим резервирования RF (29) op = 0 rc = 0 00:00:22 RF_STATUS_REDUNDANCY_MODE_CHANGE (405) IfIndex (139) op = 0 rc = 0   

В этом примере показано, как отобразить информацию о подчиненных объектах резервирования:

  Устройство №   показать подчиненные устройства резервирования   ID группы = 1 ID подчиненного устройства / процесса = 6107 Имя подчиненного устройства = [установщик] ID подчиненного устройства / процесса = 6109 Имя подчиненного устройства = [eicored] ID подчиненного устройства / процесса = 6128 Имя подчиненного устройства = [snmp_subagent] ID подчиненного устройства / процесса = 8897 Имя подчиненного устройства = [wcm] ID подчиненного устройства / процесса = 8898 Имя подчиненного устройства = [table_mgr] ID подчиненного устройства / процесса = 8901 Имя подчиненного устройства = [iosd] Номер устройства  

Этот пример показывает как отобразить информацию о состоянии устройства резервирования:

  Устройство №   показывает состояния резервирования   мое состояние = 13 -АКТИВНО одноранговое состояние = 1 - ОТКЛЮЧЕНО Режим = Симплекс ID объекта = 1 Режим резервирования (рабочий) = SSO Режим резервирования (настроен) = SSO Состояние резервирования = без резервирования Ручной Swact = отключен (система симплексная (нет равноправного устройства)) Связь = не работает Причина: симплексный режим количество клиентов = 75 client_notification_TMR = 360000 миллисекунд keep_alive TMR = 9000 миллисекунд keep_alive count = 0 keep_alive threshold = 18 RF маска отладки = 0 Номер устройства  
.

Нейтрализация

В тех же 70-х годах стало ясно, что добиться существенного улучшения ситуации с токсичностью без применения дополнительных устройств невозможно, поскольку уменьшение одного параметра влечет увеличение других. По этой причине активно занялись совершенствованием систем нейтрализации отработавших газов.

Системы нейтрализации применялись и ранее для автотракторной техники, работающей в особых условиях, к примеру на прокладке туннелœей и разработке шахт.

Существует два базовых принципа построения нейтрализаторов – термический и каталитический.

Термический нейтрализатор представляет собой камеру сгорания, которая размещается в выпускном тракте двигателя для дожигания продуктов неполного сгорания топлива – СН и СО. Он может устанавливаться на месте выпускного трубопровода и выполнять его функции. Реакции окисления СО и СН протекают достаточно быстро при температуре свыше 830 °С и при наличии в зоне реакций несвязанного кислорода. Термические нейтрализаторы применяются на двигателях с принудительным воспламенением, в которых необходимая для эффективного протекания термических реакций окисления температура обеспечивается без подачи дополнительного топлива. И без того высокая температура выпускных газов у этих двигателœей повышается в зоне реакции в результате догорания части СН и СО, концентрация которых значительно выше, чем у дизелœей.

Термический нейтрализатор (рис. 10.4) состоит из корпуса с подводящими (выпускными) патрубками и одной или двух жаровых труб-вставок из жаропрочной листовой стали. Хорошее перемешивание дополнительного воздуха, крайне важно го для окисления СН и СО, с выпускными газами достигается интенсивным вихреобразованием и турбулизацией газов при перетекании через отверстия в трубах и в результате изменения направления их движения системой перегородок. Для эффективного догорания СО и СН требуется достаточно большое время, в связи с этим скорость газов в нейтрализаторе задается невысокой, вследствие чего объём его получается сравнительно большим.

Рис. 10.4. Термический нейтрализатор

Чтобы предотвратить падение температуры выпускных газов в результате теплоотдачи в стенки, выпускной трубопровод и нейтрализатор покрывают тепловой изоляцией, устанавливают тепловые экраны в выпускных каналах, размещают нейтрализатор по возможности ближе к двигателю. Несмотря на это, для прогрева термического нейтрализатора после пуска двигателя требуется значительное время. Важно заметить, что для сокращения этого времени повышают температуру выпускных газов, что достигается обогащением горючей смеси и уменьшением угла опережения зажигания, хотя и то, и другое повышает расход топлива. К подобным мерам прибегают для поддержания стабильного пламени на переходных режимах работы двигателя. Уменьшению времени до начала эффективного окисления СН и СО способствует также жаровая вставка.

Каталитические нейтрализаторы – устройства, содержащие в себе вещества, ускоряющие реакции, – катализаторы. Каталитические нейтрализаторыбывают “однокомпонентными” “двухкомпонентными” и “трехкомпонентными”.

Однокомпонентные и двухкомпонентные нейтрализаторы окислительного типа дожигают (доокисляют) СО (однокомпонентные) и СН (двухкомпонентные).

2СО + О2 ? 2СО2 (при 250–300 ° С).

СmНn + (m + n/4)О2 ? mСО2 + n/2Н2О (свыше 400 ° С).

Нейтрализатор представляет собой корпус из нержавеющей стали, включенный в систему выпуска. В корпусе располагается блок носителя активного элемента. Первые нейтрализаторы заполнялись металлическими шариками, покрытыми тонким слоем катализатора (см. рис. 10.5).

Рис. 10.5. Устройство каталитического нейтрализатора

В качестве активного вещества использовались: алюминий, медь, хром, никель. Основными недостатками нейтрализаторов первых поколений были низкая эффективность и малый срок службы. Наиболее стойким к “отравляющему” воздействию серных, кремнийорганических и прочих соединœений, образующихся вследствие сгорания содержащихся в цилиндре двигателя топлива и масла, оказались каталитические нейтрализаторы на базе благородных металлов – платины и палладия.

Носителœем активного вещества в таких нейтрализаторах служит спецкерамика – монолит с множеством продольных сот-ячеек (рис. 10.6). На поверхность сот нанесена специальная шероховатая подложка. Это позволяет увеличить эффективную площадь контакта покрытия с выхлопными газами до ~20 тыс. м2. Количество благородных металлов, нанесенных на подложку на этой площади, составляет 2–3 грамма, что позволяет организовать массовое производство относительно недорогих изделий.

Рис. 10.6. Каталитический нейтрализатор с керамическими сотами

Керамика выдерживает температуру до 800–850 ? С. Неисправности системы питания (затрудненный пуск) и длительная работа на переобогащенной рабочей смеси приводят к тому, что избыточное топливо будет сгорать в нейтрализаторе. Это приводит к оплавлению сот и выходу нейтрализатора из строя. Сегодня в качестве носителœей каталитического слоя применяют металлические соты. Это позволяет увеличить площадь рабочей поверхности, получить меньшее противодавление, ускорить разогрев нейтрализатора до рабочей температуры и расширить температурный диапазон до 1000–1050 ? С.

Каталитические нейтрализаторы с восстановительной средой, или трехкомпонентные нейтрализаторы, используются в системах выпуска отработавших газов, как для снижения выбросов СО и СН, так и для снижения выбросов окислов азота. Каталитический слой нейтрализатора содержит, кроме платины и палладия, редкоземельный элемент родий. В результате химических реакций на поверхности разогретого до 600–800 ? С катализатора СО, СН, Nоx, содержащиеся в отработавших газах, превращаются в H2O, СО2, N2:

2NO + 2СО ? N2 + 2СО2.

2NO + 2Н2 ? N2 + 2Н2О.

Эффективность трехкомпонентного каталитического нейтрализатора достигает в реальных условиях эксплуатации 90%, но лишь при условии, что состав горючей смеси отличается от стехиометрического не более чем на 1%.

Из-за изменения параметров двигателя вследствие его износа, работы на нестационарных режимах, дрейфа настроек систем питания поддерживать стехиометрический состав горючей смеси только за счёт конструкции карбюраторов или инжекторов не представляется возможным. Необходима обратная связь, которая оценивала бы состав топливовоздушной смеси, поступающей в цилиндры двигателя.

На сегодняшний день наибольшее распространение получила система обратной связи с использованием так называемого датчика кислорода (лямбда-зонда) на базе циркониевой керамики ZrO2 (рис. 10.7).

Чувствительным элементом лямбда-зонда является циркониевый колпачок 2. Внутренняя и внешняя поверхности колпачка покрыты тонкими слоями из платинородиевого сплава, которые выполняют роль внешнего 3 и внутреннего 4 электродов. С помощью резьбовой части 1 датчик устанавливается в выпускной тракт. При этом внешний электрод омывается обработавшими газами, а внутренний – атмосферным воздухом.

Рис. 10.7. Конструкция датчика кислорода

Двуокись циркония при температурах свыше 350 ° С приобретает свойство электролита͵ а датчик становится гальваническим элементом. Величина ЭДС на электродах датчика определяется соотношением парциальных давлений кислорода на внутренней и внешней сторонах чувствительного элемента. При наличии свободного кислорода в отработавших газах датчик вырабатывает ЭДС порядка 0.1 В. При отсутствии в отработавших газах свободного кислорода ЭДС практически скачком возрастает до 0.9 В.

Управление составом смеси происходит после прогрева датчика до рабочих температур.
Размещено на реф.рф
Состав смеси поддерживается изменением количества подаваемого в цилиндры двигателя топлива на границе перехода ЭДС зонда с низкого на высокий уровень напряжения. Для уменьшения времени выхода на рабочий режим применяют датчики с электроподогревом.

Основными недостатками систем с обратной связью и трехкомпонентным каталитическим нейтрализатором являются: невозможность работы двигателя на этилированном топливе, достаточно низкий ресурс нейтрализатора и лямбда-зонда (порядка 80000 км) и увеличение сопротивления выпускной системы.

Полезные статьи по автодиагностике — Школа Пахомова

На современном диагностическом участке газоанализатор является одним из базовых приборов.

Назначение газоанализатора

К сожалению, в сознании многих специалистов автосервиса газоанализатор по-прежнему ассоциируется с регулировкой карбюратора. Это не так.

Конечно, контроль токсичности отработанных газов (ОГ) – важная функция автомобильного газоанализатора, но, тем не менее, далеко не единственная.

Прибор способен решать широкий круг задач по исследованию состояния двигателя и его систем, являясь богатейшим источником диагностической информации. Можно с уверенностью утверждать, что газоанализатор — один из основных инструментов диагноста.

Как врачу для постановки диагноза необходимы анализы пациента, так и диагносту нужны данные «анализа», чтобы выявить «болезни» двигателя, ведь состав ОГ напрямую зависит от его состояния.

Эволюция газоанализатора

Первые образцы газоанализаторов, применявшиеся для регулировки двигателя, из всей совокупности компонентов ОГ измеряли только концентрацию оксида углерода СО. Приборы были однокомпонентными.

Анализ концентрации СО позволял сделать вывод о качественном соотношении топливно-воздушной смеси и применялся в основном при регулировке карбюраторов. Такие газоанализаторы имели стрелочное отображение результатов анализа и работали на принципе измерения электрической проводимости платиновой спирали в среде оксида углерода.

К 70-м годам прошлого века остро встал вопрос необходимости контроля автомобильных токсичных выбросов. Уровень развития техники тех лет позволил создать двухкомпонентные автомобильные газоанализаторы, способные измерить концентрацию еще одного вредного компонента – несгоревшего топлива, обозначаемого СН. Эти приборы работали на принципе спектрометрирования исследуемых газов в инфракрасном диапазоне, который используется по настоящее время.

Дальнейшее развитие автомобильных газоанализаторов привело к появлению трех-, четырех- и даже пятикомпонентных приборов, позволяющих измерить концентрацию не только названных выше оксида углерода СО и углеводородов СН, но и диоксида углерода СО2, кислорода О2 и оксидов азота NОx, а также рассчитать соотношение воздух-топливо в исходной топливно-воздушной смеси.

Спектрометрический блок газоанализатора: принцип действия

Принцип действия спектрометрического блока газоанализатора основан на эффекте частичного поглощения энергии светового потока, проходящего через газ.

Молекулы каждого газа представляют собой колебательную систему, способную поглощать инфракрасное излучение в строго определенном диапазоне волн. Если через колбу с газом пропустить стабильный инфракрасный поток, то часть его будет газом поглощена. Более того, будет поглощена в основном только некоторая часть спектра потока, называемая абсорбционным максимумом данного газа. Чем выше концентрация газа в колбе, тем большее будет наблюдаться поглощение.

Тот факт, что разные газы обладают разными абсорбционными максимумами, позволяет измерить концентрацию газов в смеси, измеряя поглощение соответствующей длины волны. Иначе говоря, определить концентрацию каждого из газов в ОГ можно, анализируя снижение интенсивности светового потока в части спектра, соответствующей абсорбционному максимуму данного газа.

Спектрометрический блок прибора устроен следующим образом

Через измерительную кювету, представляющую собой трубку с закрытыми оптическим стеклом концами, прокачиваются предварительно отфильтрованные отработанные газы. С одной стороны трубки расположен излучатель. Он представляет собой нагреваемую электрическим током спираль, температура которой строго стабилизируется. Излучатель генерирует стабильный поток инфракрасного излучения.

С противоположной стороны трубки устанавливаются светофильтры, которые из всего потока выделяют необходимые длины волн, соответствующие абсорбционным максимумам исследуемых газов.

После прохождения светофильтров поток попадает в приемник инфракрасного излучения. Приемник измеряет интенсивность потока и вырабатывает информацию о концентрации газов в смеси.

Таким способом определяется концентрация СО, СН и СО2. В дальнейшем смесь газов из измерительной кюветы поступает последовательно в датчики электрохимического типа, вырабатывающие электрический сигнал, напряжение которого пропорционально концентрации кислорода О2 и оксидов азота NОx.

В современном приборе замер концентрации СО, СН и СО2 выполняется описанным спектрометрическим методом, а концентрации кислорода O2 и оксидов азота NOx — электрохимическими датчиками.

Обработка сигналов датчиков и спектрометрического блока в современном газоанализаторе выполняется электронной схемой, построенной на базе микропроцессора.

На дисплей прибора информация о содержании СО, CO2 и O2 выводится в процентах, а СН и NOx — в так называемых ppm (parts per million), «частей на миллион». Такое обозначение связано с крайне низкой концентрацией названных компонентов в ОГ и неудобством использования процентов для обозначения их количества. Соотношение между процентами и ppm выглядит следующим образом:

10 000 ppm = 1%

Поэтому количество, например, СН в ОГ типичного двигателя составляло бы около 0.001%-0.01%. Оперировать в работе такими цифрами сложно, в результате принято использовать именно ppm.

Газоанализатор – прибор сложный, и его качество определяется точностью и надежностью компонентов, в первую очередь спектрометрического блока.

Конструктивно и технологически спектрометрический блок настолько сложен и специфичен, что его производство на должном с точки зрения качества уровне освоено лишь несколькими фирмами во всем мире.

Производители непосредственно газоанализаторов используют уже готовые спектрометрические блоки, встраивая их в свои приборы. Такой подход себя оправдывает, и в приборе, произведенном в России, Италии или Корее можно обнаружить спектрометрический блок, сделанный в Японии или Америке.

Спектрометрический блок – дорогое устройство, составляющее заметную часть в стоимости прибора.

При эксплуатации очень важно обеспечить его долговечность. Механические частицы, сажа и влага, оседая на стенках блока, приводят к значительному дрейфу его показаний и даже к его полной неработоспособности.

Поэтому, прежде чем попасть в измерительный блок, отработанные газы проходят подготовку, которая производится, как правило, в несколько этапов:

  • грубая очистка отработанных газов. Выполняется фильтром, установленным на входе в прибор либо в ручке зонда забора пробы. Отфильтровываются крупные механические частицы и сажа.
  • отделитель влаги. Он может быть самых разнообразных конструкций. Назначение – отделить от потока газов капли влаги, конденсирующиеся на внутренних поверхностях зонда и соединительного шланга и удалить их. Удаление производится автоматически либо вручную оператором путем периодического слива конденсата из накопителя.
  • фильтр тонкой очистки. С его помощью производится окончательная фильтрация от мельчайших механических частиц. Фильтров может быть установлено несколько, последовательно друг за другом.

Что нужно знать при эксплуатации газоанализаторов

Особенность конструкции прибора накладывает отпечаток на его эксплуатацию и рекомендации по уходу за ним. Как правило, эксплуатация автомобильного газоанализатора не представляет большой сложности и выполняется одним оператором.

Перед выполнением измерений необходимо произвести коррекцию нуля прибора, для чего нажать на лицевой панели соответствующую кнопку. Часть газоанализаторов выполняют коррекцию нуля автоматически через заданный промежуток времени, в этом случае вмешательство оператора не требуется.

Для снятия показаний нужно установить зонд в выхлопную трубу автомобиля на глубину не менее 300 мм и зафиксировать его зажимом. Столь значительная глубина требуется для того, чтобы исключить подсос в зонд атмосферного воздуха и получение недостоверных показаний.

Далее необходимо запустить измерение и дождаться установившихся показаний на табло прибора. Длительность процесса установки показаний обычно составляет от 15 до 45 секунд и зависит от длины шланга и конструкции пневматического тракта, которая может значительно различаться у приборов разных производителей.

Основываясь на многолетней практике эксплуатации газоанализаторов, можно дать следующую рекомендацию.

После каждого замера следует отключить шланг с зондом от прибора и продуть его в обратную сторону сжатым воздухом с целью удаления конденсата. Чаще всего при этом наблюдается весьма значительное выделение влаги. Конечно, встроенный отделитель влаги свою функцию выполняет, но, тем не менее, следование данной рекомендации представляется как мера, повышающая вероятность безотказной работы прибора.

Обслуживание газоанализатора сводится в основном к периодической замене фильтров тонкой и грубой очистки. Рекомендации по их замене приводятся в руководстве по эксплуатации конкретного прибора.

Очень важно обратить внимание на следующий момент: фильтры тонкой очистки, применяемые в газоанализаторах, отличаются от бензиновых фильтров и использование последних в газоанализаторах недопустимо.

Также важно следить за тем, чтобы фильтры были сухими. Намокшие фильтры необходимо либо просушить подачей воздуха в направлении против нанесенной на корпус стрелки, либо заменить.

Анализ состава отработанных газов

Самый главный тезис, который необходимо озвучить перед изложением методики анализа состава отработанных газов, заключается в следующем.

Для грамотного и правильного анализа требуется абсолютное понимание того, откуда в составе ОГ появляется тот или иной компонент.

Нужно четко представлять течение процессов в цилиндрах и выпускном тракте двигателя, происходящие при этом химические превращения и базироваться на этом понимании.

При таком подходе диагност начинает думать и грамотно анализировать состав ОГ, видя причинно-следственные связи. Подход типа «если состав ОГ такой-то – то имеет место дефект такой-то» не представляется конструктивным и рассматриваться не будет.

Прежде всего, вспомним из школьного курса химии состав атмосферного воздуха. Это потребуется для правильного понимания происходящих в цилиндрах и в выпускном тракте двигателя процессов.

Азот

78%

Кислород

20.95%

Аргон

0.93%

Углекислый газ (СО2)

0.03%

Остальные газы, в основном инертные, присутствуют в малых количествах и в нашем случае большой роли не играют, как, впрочем, и аргон. Цифры, очень близкие к приведенным, можно увидеть на табло газоанализатора, если запустить измерение «на свежем воздухе».

Итак, в цилиндрах двигателя сгорает рабочая смесь.Реакция окисления углеводородов топлива происходит по следующей схеме:

СН + О2 => СО2 + Н2О.

Напомним, что состав смеси принято оценивать коэффициентом избытка воздуха λ. Он представляет собой отношение реального количества воздуха, поступившего в цилиндры, к теоретическому количеству, необходимому для полного сгорания топлива. Смеси, в которых количество воздуха совпадает с теоретически необходимым, называются стехиометрическими. В этом случае λ=1. Если количество воздуха больше необходимого, то смесь принято называть бедной, и коэффициент находится в диапазоне λ=1.0…1.3. Более бедная смесь перестает воспламеняться. Если же воздуха меньше необходимого, то смесь называют богатой. Такая смесь характеризуется значением λ=0.8…1.0.

Казалось бы, при сгорании стехиометрической смеси отработанные газы должны состоять из углекислого газа СО2, водяного пара Н2О и азота N2. Но на практике все происходит иначе. Под действием высокой температуры в цилиндре двигателя азот и кислород вступают в реакцию, в результате которой образуются оксиды азота. Совокупность этих оксидов обозначается NOx и отображается пятикомпонентными газоанализаторами. Образование NOx сильно увеличивается с ростом температуры газов и концентрации кислорода. Основным компонентом в смеси оксидов азота является монооксид NO. Покинув цилиндры двигателя, он окисляется в атмосфере до диоксида NО2, который гораздо более токсичен и, соединяясь в атмосфере с водяным паром, образует кислотные дожди.

Кроме того, в ОГ всегда содержатся углеводороды СН. Они представляют собой исходные или распавшиеся молекулы топлива, которые не принимали участия в сгорании, а также продукты распада моторного масла. Углеводороды появляются в ОГ вследствие гашения пламени вблизи относительно холодных стенок камеры сгорания, в защемленных объемах вроде пространства между поршнем и цилиндром над верхним компрессионным кольцом.

Часть СН выбрасывается в результате того, что на тактах впуска и сжатия горючей смеси пары топлива поглощаются масляной пленкой на стенках цилиндров. На такте рабочего хода и выпуска происходит их выделение из пленки. Аналогичный эффект поглощения паров топлива наблюдается и на нагаре, покрывающем стенки камеры сгорания.

Далее, в ОГ обязательно присутствует продукт неполного сгорания топлива — оксид углерода СО (угарный газ). Он образуется в основном во время реакции сгорания при недостатке кислорода, поэтому основное влияние на образование СО в бензиновых двигателях оказывает состав смеси: чем она богаче, тем выше концентрация СО.

Следует отметить, что данный компонент является, пожалуй, самым опасным с точки зрения воздействия на человеческий организм. Угарный газ не имеет цвета и запаха, но при вдыхании соединяется с гемоглобином крови и при высокой концентрации может вызвать смертельный исход.

Конечно же, в составе ОГ неизбежно окажется и не вступивший в реакцию кислород. Следует отметить, что кислород может оказаться в составе ОГ не из цилиндров двигателя, а из атмосферного воздуха, поступающего через места нарушения герметичности выпускного тракта.

Каталитический нейтрализатор

Многочисленные исследования показали, что улучшение процесса сгорания, оптимизация управления составом смеси и углом опережения зажигания не позволяют снизить токсичность ОГ хотя бы до уровня, обеспечивающего выполнение норм Евро II, не говоря о более высоких требованиях.

Для решения проблемы было предложено использование дополнительной обработки ОГ в выпускном тракте двигателя. Устройства, выполняющие такую обработку, называются каталитическими нейтрализаторами.

Основными частями каталитического нейтрализатора являются:

  • корпус из жаропрочной нержавеющей стали
  • блок-носитель, представляющий собой сотовую структуру из керамики или гофрированной фольги толщиной 0.1..0.5 мм
  • прослойка с пористой структурой из оксида алюминия
  • активный каталитический слой

Блок-носитель состоит из нескольких тысяч тонких каналов, сквозь которые протекают отработанные газы. Каналы керамического или металлического блока-носителя покрыты очень пористой прослойкой. Благодаря этому полезная площадь поверхности каталитического нейтрализатора увеличивается приблизительно в 7 000 раз, что обеспечивает необходимый массоперенос между ОГ и активным катализатором. На прослойку наносится каталитически активный слой.

Трехкомпонентный каталитический нейтрализатор имеет каталитически активный слой из платины (Pt), родия (Rd) и палладия (Pd). Название «трехкомпонентный каталитический нейтрализатор» говорит о том, что в одном корпусе одновременно и параллельно протекают три химические реакции превращения.

Для нормального течения этих реакций в нейтрализаторе необходимо поддерживать высокую температуру в пределах 400…800°С. При более низких температурах эффективность нейтрализатора невелика, а при температуре свыше 1000°С наступает термическое разрушение активного слоя и даже спекание сот блока-носителя.

Не вдаваясь в подробности протекающих на поверхности активного слоя химических реакций, можно привести лишь упрощенные окончательные их результаты:

  • NOx восстанавливаются до чистого азота N2 с выделением при этом свободного кислорода O2
  • СО окисляется до СO2, при этом расходуется кислород O2
  • углеводороды СН окисляются до СO2 и Н2О, при этом тоже расходуется кислород O2

Отличительной особенностью трехкомпонентного каталитического нейтрализатора является то, что для его полноценной работы необходима работа двигателя на стехиометрической топливно-воздушной смеси. Объясняется это следующим. Только при λ = 1 получается состав ОГ, в котором свободного кислорода, выделившегося при восстановлении оксидов азота, достаточно для полного окисления СО и СН до СO2 и Н2О.

Этот факт настолько важен, что его следует повторить: полноценное функционирование каталитического нейтрализатора возможно только в том случае, если двигатель работает на стехиометрической смеси.

В литературе даже используется термин «окно катализации», под которым подразумевается диапазон значений λ, при которых нейтрализатор способен выполнять свою функцию. Строго говоря, этот диапазон смещен от стехиометрии в сторону богатой смеси, и находится примерно в пределах λ = 0.98..0.99. Поддержание состава смеси в заданном диапазоне возложено на систему управления двигателем, для чего в ее состав введен датчик концентрации кислорода в ОГ.

Также необходимо упомянуть о двигателях с непосредственным впрыском топлива. Такие двигатели в некоторых режимах могут работать на сверхбедных смесях, что ведет к значительному повышению доли оксидов азота NOx. Поэтому для нейтрализации NOx в выпускной тракт устанавливается еще один катализатор, так называемого накопительного типа.

Для более полного понимания работы каталитического нейтрализатора был проведен следующий эксперимент.

Был взят автомобиль ВАЗ 2112, оснащенный ЭБУ VS5.1 с прошивкой V5D07X09, поддерживающей регулировку подачи топлива с диагностического оборудования.

  1. Нейтрализатор присутствует. Были зафиксированы показания СО, CO2, O2, СН и λ при изменении регулировочного коэффициента в диапазоне от −0.250 до +0.250.
  2. Вместо нейтрализатора установлена труба-вставка, и измерения проведены повторно.

Результаты отображены на графиках. Сплошная линия соответствует замеру с нейтрализатором, прерывистая — без него.

Графики строились вручную, с небольшой интерполяцией. Следует отметить один нюанс — по какой-то причине прибор показал неверное значения CO2 при измерении с нейтрализатором. Вероятно, это произошло из-за длительной работы двигателя при низкой частоте вращения и, соответственно, снижения температуры нейтрализатора. С этой оговоркой можно обратить внимание на полученные результаты и проанализировать их:

Первое, что бросается в глаза, — значение λ в обоих случаях практически совпало.

В диапазоне богатых смесей точки вообще образовали одну линию, в диапазоне бедных смесей наблюдается расхождение на уровне погрешности измерения. И лишь на самых бедных смесях разница заметна, но, вероятно, в том диапазоне просто невозможно корректное вычисление λ.

Вывод: независимо от наличия или отсутствия нейтрализатора рассчитанное значение λ остается одним и тем же. Собственно, по-другому и не могло быть, ведь значение λ характеризует только работу двигателя, неважно, с нейтрализатором или без него.

Очень любопытно ведет себя значение СН. Без нейтрализатора наблюдается классическая зависимость. С нейтрализатором картина интереснее. Он сильно влияет в диапазоне бедной смеси. Около стехиометрии наблюдается характерная впадина, соответствующая окну катализации. Причем при небольшом обогащении смеси относительно стехиометрии происходит очень резкий скачок значения СН, и далее оно почти сравнивается со значением, полученным без нейтрализатора.

Графики содержания кислорода очень похожи. Естественно, при работе нейтрализатора кислород расходуется, и это заметно при их сравнении.

То же самое можно сказать и о графиках СО. Совершенно четко прослеживается диапазон в районе стехиометрии, где эффективность работы нейтрализатора максимальна, и графики соответственно максимально разнятся.

Графики CO2 тоже имеют академический вид. Количество CO2 в составе ОГ в случае с нейтрализатором больше. Объясняется это тем, что последний превращает в CO2 содержащиеся в ОГ углеводороды и угарный газ. При отклонении от стехиометрии как в сторону обеднения, так и в сторону обогащения смеси, количество CO2 уменьшается.

Это очень важный момент: максимальное количество CO2 в составе ОГ приблизительно соответствует стехиометрической смеси.

Расчетный коэффициент λ

Отдельного разговора заслуживает коэффициент избытка воздуха λ. Следует четко понимать, что значение λ, отображаемое на дисплее прибора, представляет собой не реальный, а расчетный коэффициент. Он вычисляется процессором газоанализатора исходя из количества различных компонентов в составе ОГ. Вычисление производится по так называемой формуле Бертшнайдера:  

Формула приведена в качестве справочного материала и подробно разбираться нами не будет.

Расчетное значение λ будет соответствовать реальному значению только в случае, если выпускной тракт двигателя полностью герметичен, а измерительные элементы газоанализатора откалиброваны. В том случае, если выпускной тракт негерметичен (имеются подсосы атмосферного воздуха), то расчетное значение λ может оказаться не только неверным, но и превышающем все разумные пределы. Объясняется это тем, что в формуле Бертшнайдера используется содержание кислорода в ОГ, и любое появление лишнего кислорода приводит к значительной погрешности вычисления этого коэффициента.

Состав ОГ исправного двигателя

Учитывая все вышесказанное, необходимо озвучить состав отработанных газов исправного двигателя. Следует заранее оговориться, что в дальнейшем речь пойдет о работе с четырехкомпонентным прибором, так как пятикомпонентные, отображающие помимо прочего количество NOx, на участках диагностики практически не применяются из-за высокой цены. Цифры, которые будут приведены ниже, получены из многолетнего опыта применения газоанализаторов.

Прежде чем назвать их, заострим внимание на следующем моменте.

Подавляющее большинство современных бензиновых двигателей оснащено каталитическим нейтрализатором отработанных газов. Поэтому составы ОГ такого двигателя и двигателя, не оснащенного нейтрализатором, будут значительно отличаться. Исходя из этого соображения, представляется наиболее правильным рассматривать состав ОГ в выпускном тракте до нейтрализатора и после него. Эти цифры – эталон, от которого делаются все последующие выводы, можно сказать, это основа газоанализа. Их нужно запомнить и постоянно держать в голове. Итак,

— состав ОГ исправного, прогретого до рабочей температуры, работающего на стехиометрической смеси двигателя в выпускном тракте до каталитического нейтрализатора выглядит следующим образом: (табл.1)

СО

0.5%…0.7%

СН

100…200 ppm

СО2

13.5%…14%

О2

0.5%…1%

λ

1.0

— состав ОГ исправного, прогретого до рабочей температуры, работающего на стехиометрической смеси двигателя, при исправном и прогретом каталитическом нейтрализаторе, в выпускном тракте после нейтрализатора выглядит следующим образом: (табл.2)

СО

0%

СН

10…20 ppm

СО2

15%…16%

О2

0.1%…0.2%

λ

1.0

Более низкие значения СО и СН во втором случае объясняются течением химических реакций в нейтрализаторе. Процентное содержание кислорода также снизилось вследствие его расходования в реакциях окисления. Количество же диоксида углерода CO2 возросло вследствие окисления СО.

Здесь мы не видим оксидов азота NOx, но нельзя забывать, что в нейтрализаторе они восстановились до чистого азота и утратили вредное влияние на окружающую среду. Обратите внимание на то, что значение λ в обоих случаях равно 1.

Рассмотренные параметры газоанализа – эталонные, это то, что будет на табло прибора при полностью исправном, прогретом двигателе, работающем на стехиометрической смеси. Теперь поговорим об отклонениях, которые встречаются на практике и об анализе состава ОГ в этих случаях.

Негерметичность выпускного тракта

Не следует забывать, что движение газов в выпускном тракте носит сложный волновой характер, и зоны давления чередуются с зонами разрежения.

Когда место негерметичности тракта оказывается в зоне давления, отработанные газы вырываются наружу с характерным звуком (тракт «подсекает»), а когда в зоне разрежения – в выпускной тракт поступает атмосферный воздух. А теперь вспомним его состав. Даже если подсос незначителен, то содержание O2 в ОГ увеличится очень сильно, ведь в воздухе его почти 21%, а в ОГ около 0.5%. В то же время CO2 в воздухе мало, и количество этого газа в составе ОГ изменится не так значительно. То же самое можно сказать о содержании СО и СН.

В случае подсоса воздуха в выпускной тракт имеет место неестественно большое количество O2 в составе ОГ. Можно утверждать, что первый параметр, который необходимо оценить при анализе состава отработанных газов, — это именно содержание кислорода. Если оно превышает 1.5..2%, то присутствует подсос атмосферного воздуха в выпускной тракт.

Дальнейший анализ не имеет смысла без устранения дефектов тракта. Нужно оговориться, что большое количество кислорода в составе ОГ будет наблюдаться и при пропусках воспламенения, но для них характерно большое количество несгоревшего топлива, и спутать две этих ситуации практически невозможно.

Конечно, при наличии подсоса анализировать остальные параметры состава ОГ попросту бессмысленно. Отметим лишь, что расчетный коэффициент λ в такой ситуации приобретает запредельные значения. Косвенно они тоже указывают на описываемый дефект.

Богатая смесь

В этом случае λ ‹ 1, воздуха в смеси меньше необходимого для полного сгорания. Несложно прийти к выводу о том, что при недостатке кислорода сгорание происходит не полностью и в ОГ содержится больше СН, чем при стехиометрической смеси. Содержание СО возрастет по этой же причине. Количество CO2 станет меньше, чем при работе на стехиометрической смеси, ведь топливо сгорело неоптимальным образом. Поэтому состав ОГ двигателя, работающего на обогащенной смеси без нейтрализатора, выглядит приблизительно так: (табл.3)

СО

1%…5%

СН

300…400 ppm

СО2

11%…13%

О2

0.3%…0.5%

λ

0.8..0.99

Нужно отметить, что при наличии каталитического нейтрализатора незначительное обогащение смеси по составу ОГ можно и не обнаружить, но любое серьезное отклонение приведет к выходу из окна катализации и явному уходу состава ОГ от нормы. В этом случае цифры на табло прибора будут похожими на приведенные выше.

Применительно к современным двигателям в качестве причин богатой смеси можно назвать повышенное давление топлива, дрейф характеристики ДМРВ, поступление топлива через неплотную мембрану вакуумного регулятора давления (на системах с обратным сливом топлива).

Причиной может быть и неисправный ДТОЖ, подобный дефект легко обнаруживается по показаниям сканера. Отдельно следует упомянуть такой хитрый дефект, как подсос воздуха в выпускной тракт перед сигнальным датчиком кислорода. В такой ситуации атмосферный кислород регистрируется датчиком, что приводит к значительному обогащению смеси и даже возникновению соответствующего кода неисправности.

Еще один источник лишнего топлива в смеси – моторное масло.

Здесь следует сделать небольшое отступление. Дело в том, что масляная пленка на зеркале цилиндра играет далеко не последнюю роль в формировании рабочей смеси и процессах, происходящих в камере сгорания. Если по какой-либо причине двигатель долго работал на слишком богатой смеси либо просто запустился не с первого раза, что очень часто бывает зимой, то в масло попадает бензин.

Можно предположить, что несгоревший бензин стекает по стенкам цилиндров или просто проникает через замки поршневых колец. Так или иначе, но бензин в масло попадает, и надо принять это как реальность. Какими путями он поступает в дальнейшем в камеры сгорания — есть два предположения. Пары бензина вместе с картерными газами движутся по системе вентиляции картера и смешиваются во впускном коллекторе с воздухом. Но, как показывает практика, если отсоединить шланги вентиляции картера от впускного коллектора, то смесь обедняется незначительно. Однако после замены моторного масла все приходит в норму.

Отсюда становится возможным сделать вывод: молекулы топлива попадают в камеру сгорания из масляной пленки на стенках цилиндров. Ведь стенки смазываются разбрызгиванием, и при каждом ходе поршня пленка масла обновляется. Описанное явление ни в коем случае не должно вводить диагноста в заблуждение: если после неудачной попытки зимнего запуска наблюдается богатая смесь либо заниженный коэффициент коррекции подачи топлива, то это абсолютно нормальное явление. В такой ситуации есть смысл рекомендовать замену моторного масла во избежание повышенного механического износа двигателя и снижения рабочих свойств самого масла.

Бедная смесь

Такая смесь характеризуется значением λ › 1 и избыточным количеством воздуха. Несложно прийти к выводу, что при избытке в смеси воздуха количество остаточного кислорода в ОГ возрастет. Количество СН изменится незначительно, ведь одна из причин появления паров топлива в ОГ заключается в гашении пламени в защемленных объемах, и это не зависит от состава смеси. Заметно снизится значение СО. Связано это прежде всего с избытком кислорода и окислением СО до CO2. Несмотря на это, процент CO2 относительно стехиометрической смеси снизится вследствие общего увеличения количества газов. Конечно же, расчетный коэффициент λ окажется выше 1. Состав ОГ двигателя, работающего на обедненной смеси и не оснащенного нейтрализатором, приведен ниже (табл.4):

СО

0.1%…0.4%

СН

150…250 ppm

СО2

12%…13%

О2

1%…2%

λ

1.01..1.3

В качестве причин бедной смеси современного двигателя можно назвать, прежде всего, подсос воздуха в задроссельное пространство. Путей много: это и вакуумный усилитель тормозов, и разрушение уплотняющих прокладок впускного коллектора, износ пары ось-втулка дроссельной заслонки, старение резиновых уплотнений форсунок и регулятора холостого хода. Локализовать место подобного дефекта можно с использованием генератора дыма.

Помимо подсоса воздуха, причиной обеднения смеси могут являться пониженное давление топлива вследствие износа бензонасоса или засорения топливного фильтра и магистрали, снижение производительности форсунок, неверные показания ДМРВ.

Обнаружить работу на бедной смеси двигателя, оснащенного каталитическим нейтрализатором, довольно сложно. Дело в том, что при выходе из окна катализации в сторону обеднения нейтрализатор продолжает оказывать значительное влияние на состав ОГ. В этом случае необходимо воспользоваться значением CO2 и оценить эффективность сгорания в целом.

Высокое содержание СН

У двигателя без нейтрализатора нормальное значение этого параметра – 100..200 ppm. Если на табло прибора видим СН, равный 300..400 и более, это повод искать причину, по которой бензин попросту не сгорает, другими словами, имеют место пропуски воспламенения.

Причин таких пропусков можно назвать много. Изношенные или неисправные свечи, высоковольтные провода, дефектный модуль зажигания, не отрегулированные тепловые зазоры клапанов, пониженная компрессия, неисправная форсунка. Причем все это — как в одном, так и в нескольких цилиндрах. Еще одна причина повышенного содержания в ОГ паров топлива — неплотный или начинающий прогорать выпускной клапан. В этом случае на такте сжатия часть топливного заряда попросту выталкивается в выпускной тракт. Двигатель при этом может работать вполне нормально, и остальные параметры газоанализа будут в норме. Приведенная ниже таблица содержит пример состава ОГ реального двигателя без нейтрализатора, имеющего дефектные свечи (табл.5):

СО

0.34%

СН

384 ppm

СО2

12.8%

О2

2.02%

λ

1.085

Все остальные системы двигателя заведомо в полном порядке. Проанализируем полученные данные.

Повышенное содержание в ОГ паров топлива говорит о том, что последнее попросту не сгорает.

Содержание СО ниже соответствующего стехиометрической смеси, и его значение позволяет сделать вывод, что богатая смесь не имеет места.

Высокое содержание кислорода вкупе с высоким же количеством СН позволяет сделать предположение о пропусках. Откуда появляется кислород? Из цилиндров двигателя, которые при пропусках попросту выбрасывают атмосферный воздух, смешанный с парами топлива. СО2 ниже нормы, что тоже говорит о ненормальном сгорании. Ну и расчетный коэффициент λ — прибор рассчитывает его, исходя помимо прочего и из содержания кислорода. Именно пропуски воспламенения и наблюдались на исследуемом двигателе, они были хорошо слышны у среза выхлопной трубы.

В случае двигателя без нейтрализатора при возникновении пропусков особых проблем, кроме повышенного выброса токсичных веществ, нет. Но на двигателях, оснащенных нейтрализатором, пропуски воспламенения приводят к его недопустимому разогреву. Несгоревшие пары топлива в смеси с кислородом воздуха вступают на поверхности блока-носителя в реакцию, вызывая выделение большого количества теплоты. Температура блока-носителя и корпуса нейтрализатора повышаются до значений 1000°С и более. Это явление очень опасно и может привести, например, к возгоранию сухой травы под днищем автомобиля либо к повреждению прилегающих к нейтрализатору элементов.

На практике неоднократно наблюдалось расплавление шумоизоляции салона, разрушение изоляции прилегающих к кузову электрических проводов и короткое замыкание в них.

Но в первую очередь пропуски воспламенения и последующий перегрев нейтрализатора приводят к разрушению последнего. В керамическом блоке-носителе происходит спекание сот, вызывая при этом повышение газодинамического сопротивления выпускного тракта.

Если блок-носитель выполнен из стальной фольги, как правило, его спекания не происходит, но разрушается каталитический активный слой, и нейтрализатор перестает выполнять свою функцию. Так или иначе, но пропуски воспламенения в двигателе, оснащенном нейтрализатором, представляют собой очень опасное явление.

В связи с этим современная система управления двигателем ведет мониторинг пропусков и при их обнаружении отключает неисправный цилиндр.

Анализ количества СО2

Как уже упоминалось выше, этот компонент ОГ представляет собой продукт самого полного сгорания топлива. Чем лучше сгорело топливо в цилиндрах двигателя (и «догорело» в нейтрализаторе), тем выше будет количество СО2в составе ОГ.

Данное утверждение может оказаться несправедливым применительно к двигателю с непосредственным впрыском бензина в цилиндры при работе на сверхбедной смеси. Но в настоящий момент речь идет о более массовых двигателях с впрыском в коллектор. У исправного двигателя, не оснащенного нейтрализатором, в ОГ содержится примерно 14% СО2, у оснащенного – 16%. Называя эти цифры, сложно утверждать, что именно их вы увидите на табло своего прибора. Лучше всего посмотреть, каковы будут показания у того прибора, который вы используете, и оперировать в своей работе именно ими. Но общий принцип анализа от этого не изменится.

Получив значение СО2, следует его оценить

Если оно примерно совпадает со значением, максимально достижимым для данного типа двигателей (см. табл. 1,2), то можно сделать вывод, что проблем с подачей топлива и формированием топливно-воздушной смеси нет. Напротив, снижение количества СО2 должно насторожить, ибо это признак проблемы.

Конечно, газоанализатор не укажет на неисправный датчик или элемент, но он подскажет направление поиска дефекта или хотя бы укажет на его наличие.

В практике автора были случаи, когда по всем параметрам работа двигателя вроде бы укладывалась в норму, но количество СО2 в ОГ говорило о наличии проблемы. В итоге дефект обнаруживался, и принимались меры к его устранению. Именно этот критерий позволяет оценивать работу двигателя, оснащенного нейтрализатором, не обращаясь к значениям СО и СН, которые в этом случае близки к нулю и не несут информации.

Контроль состояния каталитического нейтрализатора

Современные электронные блоки управления двигателем контролируют состояние нейтрализатора и выставляют в случае снижения его эффективности соответствующий код неисправности. Однако приговаривать весьма дорогостоящий узел к замене на основании только выставленного блоком кода не представляется разумным.

Необходимо убедиться в правильности диагноза, и в этом случае газоанализатор – единственный прибор, способный вам помочь. Методика оценки работоспособности нейтрализатора основана на принципе его работы. Так как свою функцию он начинает выполнять только при достаточно высокой температуре и работе двигателя на стехиометрической смеси, необходимо прогреть двигатель до включения вентилятора и при помощи сканера убедиться в том, что петля обратной связи по датчику кислорода замкнута. Затем производится анализ состава ОГ.

В первую очередь выполняется проверка состава ОГ при работе двигателя на частоте вращения холостого хода. Если нейтрализатор исправен, состав ОГ будет соответствовать приведенному выше эталонному для двигателя с нейтрализатором (табл. 2). В том случае, если наблюдается увеличенное содержание СО (0.1%…0.6%) и СН (50…200 ppm), а также сниженное количество СО2, нейтрализатор утратил свою работоспособность.

Если же никаких проблем нет и цифры на табло соответствуют эталону, следует увеличить частоту вращения примерно до 4000 rpm и повторно снять показания газоанализатора.

Идея методики такова. При малом потоке ОГ, характерном для низкой частоты вращения, нейтрализатор успевает полноценно обработать вредные компоненты. При большом потоке на высокой частоте вращения его эффективности может не хватить. Поэтому критерием исправности нейтрализатора может считаться его способность обеспечить эталонные параметры состава ОГ при высокой частоте вращения.

Ради интереса можно провести следующий эксперимент. Подключаем газоанализатор к выхлопной трубе холодного двигателя, запускаем двигатель и следим за составом ОГ. Можно четко отследить первоначальную работу двигателя на обогащенной смеси, затем постепенное изменение параметров в сторону стехиометрической смеси и, наконец, смещение параметров к эталонным для двигателя с нейтрализатором.

Такие эксперименты очень полезны, так как они наглядно связывают теорию работы двигателя и системы управления с практическими результатами его работы, наблюдаемыми с помощью приборов.

Газоанализ и диагностика: краткие итоги

В работе с газоанализатором необходим творческий подход.

Здесь нельзя пользоваться никакими алгоритмами. Нужно критически оценивать цифры на табло прибора и размышлять о том, почему они именно такие, откуда появился тот или иной компонент.

Самые основные, базовые моменты анализа состава ОГ были нами рассмотрены, теперь дело за практикой и наработкой вашего собственного опыта.

Iveco Stralis Hi-Way — смотрины грузовика

Итальянская компания Iveco S.p.A. имеет 24 завода, расположенные в 11 странах. Исследования ведутся в 6 научно-исследовательских центрах. Инвестиции в НИОКР составили 254 млн евро. В прошлом году было продано 153384 автомобиля марки Iveco. Продавать технику помогает собственная финансовая структура Iveco Capital, предлагающая индивидуальные решения для приобретения продукции компании.


Флагман модельного ряда Iveco — магистральный тягач Stralis Hi-Way — был представлен общественности 1 июля прошлого года. Новый тягач убедительно победил на европейском конкурсе The International Truck of the Year, получив 138 голосов журналистов (занявший второе место Mercedes-Benz Antos набрал 107 голосов).


В последние два года Iveco Stralis занимали 6% российского рынка тяжелых грузовиков. По заверению компании, при разработке нового грузовика основная ставка делалась на сокращение совокупной стоимости владения транспортным средством. В результате удалось снизить стоимость обладания автомобилем на 4%.


В связи с вступлением с начала года в силу экологических требований Евросоюза — Правил (Regulation) № 595/2009 в отношении эмиссии новых типов тяжелых транспортных средств, больше известных как Euro-6 — новый грузовик Iveco как автотранспортное средство нового типа соответствует этому документу. Для выполнения жестких норм Правил № 595/2009 инженеры компании разработали инновационную систему нейтрализации отработавших газов HI-eSCR — запатентованную разработку подразделения FIAT компании FPT Industrial S.p.A. (FPT Industrial).


Система HI-eSCR, название которой расшифровывается как High Efficiency SCR, позволяет грузовику выполнять нормы Euro-6, обходясь только селективным каталитическим нейтрализатором (Selective Catalytic Reduction) без применения системы рециркуляции отработавших газов EGR. Система EGR основана на уменьшении эффективности рабочего процесса — разбавлении топливо-воздушного заряда отработавшими газами. Система SCR воздействует исключительно на отработавшие газы. Конечно, не все так просто. Нормы Euro-6 настолько жесткие, что десять лет назад воспринимались как фантастические. Пять лет назад все еще не было уверенности, что они выполнимы. Казалось, что спор между поклонниками EGR и их оппонентами, отдающими предпочтение SCR, при переходе на Euro-6 будет решен в пользу обеих систем. Многим система SCR не нравилась тем, что на борту автомобиля требуется возить раствор мочевины AdBlue, хотя это небольшая проблема. К плюсам SCR стоит отнести то, что двигатели с этой системой меньше требовательны к качеству топлива и масла, чем двигатели с EGR.


В принципе, система HI-eSCR ведет свою «родословную» от технологии SCR Only, разработанной FPT Industrial в 2011 г. для дизелей с целью их соответствия требованиям стандартов Tier 4 Final/Stage IV. Затем система была адаптирована для использования в грузовых автомобилях и автобусах, которые должны соответствовать нормам Euro-6.


Готовясь к выпуску грузовиков семейства Stralis Hi, компания провела реконструкцию производства. Инвестиции составили 70 млн евро. Было проведено усиление контроля качества на 40%. После проведенных работ завод в Мадриде завоевал серебряную медаль WCM (World Class Manufacturing) — системы управления производственными процессами. Была модернизирована линия окраски и подготовки кабин к окраске. Технологические усовершенствования позволили, в частности, увеличить толщину защитного катафорезного слоя на 30%.


Для изготовления элементов рамы стали применять новую технологию — Rollforming. Теперь краска лучше ложится на детали рамы. Таким образом, возрос уровень антикоррозийной защиты. Для особых условий эксплуатации предлагается дополнительная защита рамы от коррозии.

Инвестиции в разработку нового грузовика составили 300 млн евро. Их них 120 млн пошло на новые технологии, а 180 млн было потрачено на создание двигателя, соответствующего требованиям Euro-6. Опытные грузовики прошли 5 млн км при испытании на усталость. 11 млн км было пройдено при тестировании на дорогах общего пользования.


Семейство новых тягачей Stralis состоит из моделей Hi-Road, Hi-Way, Hi-Street. Для грузовиков моделей Hi-Way предназначается кабина AS (бывшая Active Space) шириной 2500 мм и высотой 1989 или 1516 мм. На «дорожники» Hi-Road устанавливается кабина АТ (бывшая Active Time). Ее ширина — 2300 мм, высота — 1880 или 1210 мм. «Горожане» Hi-Street будут довольствоваться кабиной AD (бывшая Active Day) — короткой версией АТ.


Кабины получили новый дизайн экстерьера и интерьера. Обивка кабины выполнена из износоустойчивых материалов темного матового цвета. В кабине установлено новое сиденье, увеличен холодильник, смонтирован парковочный кондиционер и спальное место повышенной комфортабельности. Водитель получил в помощники ассистента торможения (BAS), системы предупреждения пересечения линии (LDWS), оценки манеры вождения (DSE), поддержания внимания (DAS). К услугам водителя новые медиа и навигационные системы, телематическое оборудование, адаптивный круиз-контроль (АСС).


Система оценки манеры вождения Iveco DSE (Driving Style Evaluation) учитывает такие аспекты управления грузовиком как разгон, движение накатом, переключение передач (выбор передачи, ненужные переключения), торможение (двигателем или вспомогательным тормозом, а также частоту торможений). Получив входные данные, DSE на основе программы математического моделирования рассчитывает необходимое количество топлива и сравнивает это значение с количеством израсходованного.

Данные, собранные системой Iveco DSE, могут быть переданы для обработки в компьютерную программу FleetVisor. FleetVisor является эффективным инструментом мониторинга анализа работы как отдельного водителя, так и всего автопарка в целом.


Снаружи новые кабины отличаются решеткой радиатора, боковыми дефлекторами, фарами с использованием светодиодных источников света, новым солнцезащитным козырьком со светодиодными габаритными огнями. Под бампером установлен новый фартук. В фарах применяются ксеноновые лампы, дневные ходовые огни (DRL).


По заверениям компании, кабины нового Stralis Hi-Way получили лучшую на рынке шумоизоляцию. При работе двигателя на холостом ходу уровень шума на рабочем месте водителя снизился на 0,7 дБ. При скорости движения 70 км/ч шум снижается на 1,3 дБ. Для оценки уровня шума использовался показатель разборчивости. При 100% разборчивости все произносимые слова будут понятны. При 0% разборчивости невозможно ничего разобрать. На холостом ходу разборчивость возросла на 5%; при скорости 50 км/ч — на 8%; при скорости 70 км/ч — на 10%.


В семейство двигателей HI-eSCR входят дизели: Cursor 9, развивающие мощность 310, 360 и 400 л.с., крутящий момент от 1300 до 1700 Нм; два Cursor 11 мощностью 420 или 460 л.с. с крутящими моментами 1900 и 2150 Нм; а также два 13-литровых двигателя мощностью 500 (2300 Нм) и 560 л.с. (2500 Нм). Эти модели представляют собой переконструированные двигатели Euro-5 рабочим объемом 8, 10 и 13 литров. Также предлагается три 8-литровых газовых двигателя Euro-6 мощностью 270, 300 и 330 л.с. В новых двигателях была переработана конструкция блока и головок цилиндров. Двигатели Euro-6 оснащаются топливной системой Common Rail с давлением впрыска до 2200 бар. Была изменена система вентиляции картера с целью улучшить отделение масла из картерных газов. Такая мера значительно понижает риск загрязнения сажевого фильтра (DPF).


Кроме сажевого фильтра в систему очистки отработавших газов входят так называемый дизельный катализатор DOC и очистительный катализатор для нейтрализации аммиака (CUC). Специализированный катализатор DOC применяется для создания экзотермического эффекта путем окисления дизельного топлива и повышения температуры отработавших газов, необходимой для активной регенерации сажевого фильтра. По сути, DOC — это двухкомпонентный нейтрализатор, предназначенный для окисления NO и CO. Благодаря DOC и тому, что система High Efficiency SCR удаляет свыше 95% окислов азота, на автомобиле используется пассивный DPF, то есть, в котором происходит непрерывное окисление сажи за счет действия катализатора и высокой температуры отработавших газов (350-500°С).

На двигателях семейства HI-eSCR установлен новый моторный тормоз SEB (Super Engine Brake). Тормозная мощность SEB на 30% выше, чем предшественника. Работа нового моторного тормоза интегрирована в тормозную систему, как и гидродинамический интардер, если последний установлен.

На грузовики Iveco Stralis Hi-Way могут устанавливаться механические, роботизированные или автоматические коробки передач. Механические передачи представлены агрегатами с 9-ю передачами для двух самых маломощных двигателей (Cursor 8 Typ S31 и S33). Дизели Cursor 8 могут работать в паре с автоматическими передачами Allison S3200. Остальные дизели агрегатируются с 16-ступенчатыми коробками с ручным переключением или 12-ступенчатыми «роботами» от ZF.

Периодичность обслуживания автомобиля увеличилась до 150 тыс. км.

При эксплуатации Iveco Stralis Hi-Way расход топлива снижается на 5-12%. Из них 1% экономии дает уменьшение на 3% аэродинамического сопротивления.

Warm up oxidation catalytic converter | English to Russian

warm up oxidation catalytic converter

Прогреть каталитический нейтрализатор отработавших газов

Explanation:
Нейтрализатор на основе окислительного катализатора.

«…Нейтрализатор представляет из себя кусок керамики со множеством отверстий покрытых слоем платины и родия, всё это облачено в металлический корпус. Нейтрализатор имеет окислительный и восстановительный катализаторы которые ускоряют процесс преобразования окиси углерода, углеводордов и окислов азота в нетоксичные соединения. Окислительным катализатором является платина, которая способствует окислению углеводородов и окиси углерода в водяной пар и двуокись углерода. Восстановительный катализатор-родий, ускоряющий реакцию восстановления окислов азота в безвредный азот…»
http://injector.city.tomsk.net/neitr.html

—————————————————
Note added at 20 mins (2004-09-02 11:15:12 GMT)
—————————————————

Нет, точнее все-таки — каталитический нейтрализатор отработавших газов с принудительным подогревом…

\»…В последнее время началось постепенное внедрение более прогрессивных и эффективных систем. У нового поколения каталитических нейтрализаторов вместо керамики применяется металлическая сетка. Это позволяет посредством принудительного подогрева выводить катализатор на рабочую температуру сразу же после пуска двигателя…\»
http://www.katalizator.lt/index.php?l=3&p=11

—————————————————
Note added at 24 mins (2004-09-02 11:19:26 GMT)
—————————————————

ИЛИ даже — каталитический нейтрализатор отработавших газов с системой разогрева до рабочей температуры…

\»…К описанным выше устройствам нужно еще добавить кислородный датчик (лямбда-зонд), который сообщает компьютеру двигателя о работе нейтрализатора, а также ***систему разогрева катализатора до рабочей температуры***, иначе первое время (до 40 минут) он не будет выполнять свои функции…\»
http://arch.zr.ru/articles/48_07_1997.html

—————————————————
Note added at 32 mins (2004-09-02 11:27:46 GMT)
—————————————————

И все-таки \»Warm Up\» имеет здесь описательное значение нейтрализатора:
\»…The following abbreviations and acronyms are used within the certification data reports for the Motor Vehicle and Engine Certification Program:
WUOC — Warm Up Oxidation Catalytic Converter
WUTWC — Warm Up Three-Way Catalytic Converter
WUTWC-TWC — Warm Up Three-Way Catalytic Converter Three Way Catalytic Converter…\»

—————————————————
Note added at 34 mins (2004-09-02 11:29:15 GMT)
—————————————————

Забыл ссылку указать к последнему комментарию:
www.arb.ca.gov/msprog/mvcert/abbrev.htm

—————————————————
Note added at 55 mins (2004-09-02 11:50:25 GMT) Post-grading
—————————————————

Thanks for the grade, Asker!

стоит ли удалять, возможные неисправности катализатора, можно ли ездить без него

Эдуард Солодин

разбирался в катализаторах

Профиль автора

Я ехал по трассе, и у машины пропала тяга. Хорошо, что это не случилось при обгоне.

Я добрался до ближайшего автосервиса и удалил катализатор. Потом заплатил за работу и оставил все, что от этого катализатора осталось, ребятам из автосервиса. Тогда я еще не знал, что эта деталь содержит драгоценные металлы и за все, что от него осталось, дают хорошие деньги. В следующий раз буду умнее: проезжу на машине до 100 000 км, потом удалю, а катализатор оставлю себе или расплачусь им за работу.

Из-за таких историй некоторые автовладельцы считают катализатор бомбой замедленного действия и спешат поскорее его удалить. В некоторых автосервисах этому рады и советуют удалять катализаторы даже на новых машинах. Они утверждают, что это лишняя деталь, которую навязывают автопроизводителям экологи, и что автомобиль после этого будет ехать бодрее, а расход топлива уменьшится.

Я попытался разобраться, насколько катализатор лишняя деталь в автомобиле и можно ли его удалять. Из этой статьи вы узнаете, как работает катализатор, какие типы катализаторов бывают, из-за чего они выходят из строя и какие есть признаки неисправного катализатора.

Катализатор расположен в выхлопной системе автомобиля, ближе к выпускному коллектору двигателя, и нужен для очистки отработавших газов от вредных выбросов. Источник: Setta Sornnoi / Shutterstock

Что такое катализатор и зачем он нужен

Двигатель внутреннего сгорания работает на воздушно-топливной смеси. Она сгорает с образованием токсичных выхлопных газов, а на бензиновых двигателях какая-то часть смеси может вообще не сгореть и улететь в выхлопную трубу. Чтобы хоть как-то снизить концентрацию вредных веществ в выхлопных газах, на их пути ставят каталитический нейтрализатор отработавших газов: катализатор, если по-простому. Выхлопные газы идут через него, как через фильтр.

Технически это огнеупорный керамический или металлический цилиндр с сотами, через которые проходят отработавшие газы, в составе которых есть вредные вещества: углеводород, оксид азота, окись углерода. На стенках этих сот есть микрослой веществ-катализаторов: это может быть платина, палладий или родий. Они ускоряют химические процессы, и выхлопные газы после окислительно-восстановительных реакций с этими металлами становятся менее токсичными.

Соты исправного керамического катализатора. Источник: Anton Tolmachov / Shutterstock

В основном катализаторы ставят в выхлопной системе автомобилей с бензиновыми двигателями. Их может быть несколько: например, если из двигателя идет две отдельные выхлопные трубы, ставят по одному на каждую. Бывает, что катализаторы ставят последовательно на одной выхлопной трубе.

Для очистки выхлопных газов дизельного двигателя чаще всего применяют сажевые фильтры. Конструкция примерно такая же, только ячейки фильтра закрыты с одной из сторон. Выхлопные газы находят выход через пористые стенки каналов, на которых оседает сажа. Такие фильтры периодически требуют очистки. Для этого внутри фильтра повышается температура, и частицы сажи догорают. Этот процесс называют активной регенерацией.

Еще катализатор снижает температуру газов. Например, на входе в катализатор температура газов около +390 °C, а на выходе — уже +260 °C. Примерно в таком температурном режиме и проходят химические реакции, поэтому какое-то время после запуска двигателя катализатор не работает.

НОВЫЙ КУРС

Как сделать ремонт и не сойти с ума

Разбираемся, как начать и закончить ремонт без переплат: от проекта до приемки

Покажите!

Работает катализатор или нет, определяет второй кислородный датчик, он же лямбда-зонд. Его ставят после катализатора, и его задача — определять уровень токсичности выбросов. Если его просто удалить, датчик зафиксирует низкую эффективность катализатора, и на приборной панели появляется ошибка Check engine.

Существуют различные экологические классы для вредных выбросов автомобиля: Евро-2, Евро-3, Евро-4, Евро-5 и Евро-6. В России для новых автомобилей с 2016 года действует стандарт Евро-5. Узнать экологический класс своего авто можно в паспорте транспортного средства. По опыту работников автосервиса, чем выше экологический класс автомобиля, тем меньше ресурс катализатора. Стенки керамических сот у таких катализаторов тоньше, ячейки расположены плотнее, чтобы работать эффективнее.

Экологический класс указан в 13-м пункте паспорта транспортного средства

Виды катализаторов и их заменители

Оригинальный катализатор устанавливает завод-изготовитель. Такой может стоить до 5% от стоимости всего автомобиля. В России мало предприятий по производству катализаторов. В основном их делают за границей, их стоимость зависит от госпошлины, курса доллара и курса драгметаллов. Заменить катализатор на оригинальный стоит от 25 000 Р.

Обычно такую замену делают на гарантийных машинах, если по каким-то причинам он вышел из строя или его украли. Срок службы оригинального катализатора обычно не меньше гарантийного срока автомобиля.

Цена на новый оригинальный катализатор для Хендай Солярис 1,6 л 2017 года — от 58 000 Р

Универсальный катализатор заменяет оригинальный почти для любого автомобиля. Он стоит дешевле оригинального, и срок его службы меньше. В теории он должен прослужить примерно 60 000 км. Цены на универсальный катализатор — от 5000 Р. В ячейках таких катализаторов вместо платины, палладия и родия применяют, например, золото. Оно хуже ускоряет каталитические реакции, поэтому хуже очищает выхлопные газы от вредных веществ.

При выборе универсального катализатора важно правильно определить его объем, который не должен быть меньше оригинального. Корпус катализатора не всегда круглой формы, у него разная длина и ширина. Отработавший катализатор вырезают из корпуса болгаркой, а новый вваривают на его место. Лучше, чтобы эти работы проводил опытный сварщик, который сделает качественный сварной шов.

Установка универсального катализатора — это компромисс для тех, кто не хочет или не может купить оригинальный катализатор, но заботится об экологии или хотя бы хочет пройти техосмотр.

Универсальный металлический катализатор Евро-5. Устанавливается на место старого катализатора

Пламегаситель в английских руководствах по ремонту выхлопных систем — это «предварительный глушитель». Он смешивает потоки отработавших газов из разных цилиндров, снижает их температуру, а также сводит уровень шума и вибрацию до приемлемого уровня. Его устанавливают вместо катализатора, но он никак не влияет на токсичность отработавших газов.

Если не установить пламегаситель после удаления катализатора, то выхлопная система со временем прогорит из-за высокой температуры отработавших газов. Простой пламегаситель — это труба с перфорацией для газов в стальном корпусе. Цены на пламегасители начинаются от 760 Р.

Между корпусом и трубой пламегасителя проложен огнеупорный наполнитель. Обычно это базальт, синтетическое волокно или минеральная вата. Корпус пламегасителей может быть однослойным или двухслойным. Двухслойные также называют реактивными. Они более долговечны и хорошо гасят колебания звуковой волны. Внутренний слой должен выдерживать воздействие высоких температур, а внешний — коррозии.

Для каждого автомобиля нужно рассчитать оптимальный объем пламегасителя. Если объема пламегасителя будет недостаточно, то звук на выходе будет неприятным, дребезжащим. Те элементы глушителя, которые находятся после пламегасителя, подвергаются повышенному износу и быстрее выходят из строя.

По сравнению со стоимостью оригинального катализатора установить пламегаситель дешевле — от 3500 Р. Его установка предполагает перепрошивку блока управления двигателем (ЭБУ) или установку специальной «обманки» для электронного блока управления. Подробнее про них мы напишем чуть ниже.

Внутри пламегасителя труба с перфорацией и огнеупорный наполнитель. Источник: CameraMan32 / Shutterstock

Можно ли удалить катализатор

Катализатор по умолчанию рассчитан на весь срок службы автомобиля. Но качество топлива и тяжелые условия эксплуатации разрушают его значительно раньше: например, при пробеге 100 000 км.

Нет универсального или регламентированного срока удаления катализатора — каждый случай индивидуален. Неисправный катализатор доставляет множество проблем: от назойливой лампочки Check engine до попадания керамической пыли в цилиндры двигателя. Поэтому у большинства автомобилей старше десяти лет катализатор уже удален.

Есть такие выхлопные системы, при которых катализатор расположен очень близко к двигателю. В случае когда он начинает разрушаться, дисперсионная пыль от него летит в сторону двигателя. Она очень мелкая и твердая, ее можно сравнить с мелким песком. Она царапает цилиндры двигателя при работе поршней. Из-за этих царапин двигатель начинает потреблять масло или его расход увеличивается — это в случае, если двигатель потребляет его с первых дней эксплуатации автомобиля.

Рано или поздно это приводит к капитальному ремонту двигателя. Некоторые автовладельцы хотят избежать таких неприятных последствий и удаляют катализатор еще до того, как он начнет разрушаться.

Замена катализатора на новый — дорогостоящая процедура: один катализатор может стоить 100 000 Р, а теперь представьте, что их в машине два и оба износились примерно одинаково. Поэтому вместо нового катализатора в выхлопную систему чаще всего устанавливают пламегаситель с «обманкой» или, что гораздо реже, — универсальный катализатор.

Внутри обманки небольшой кусочек катализатора. Ее ставят на второй лямбда-зонд, а часть обманки с сеткой вкручивают в выхлопную систему после пламегасителя. Благодаря устройству ЭБУ автомобиля думает, что отработавшие газы в порядке, катализатор на месте, и Check engine на приборной панели не загорается. Тем не менее обманка не гарантирует, что ошибка не появится: лампочка может загореться после заправки не самым хорошим бензином или после резкого разгона

Обманка для второго лямбда-зонда

Можно обойтись без обманки. Для этого нужно перепрошить электронный блок управления и настроить его так, чтобы лямбда-зонд воспринимал новые «вредные» показания датчиков как норму. В объявлениях эту процедуру называют перепрошивкой под Евро-2 и обещают, что машина будет ехать бодрее, двигатель будет выдавать на 20—30 лошадиных сил больше.

Вместе с этим любое вмешательство в оригинальное программное обеспечение ЭБУ — риск, поэтому перепрошивку должен делать квалифицированный специалист с проверенной программой. Выхлопные газы автомобиля при установке пламегасителя фактически не очищаются, но ошибка Check engine на приборной панели из-за перепрошивки не появится. Очень важно помнить, что несмотря на это двигатель, скорее всего, проектировали под более высокий экологический класс, а значит, с настройками под Евро-2 он проработает гораздо меньше, чем мог бы.

Установка обманок, пламегасителей вместо нового оригинального катализатора может привести к неожиданным последствиям: ошибкам двигателя, неприятному запаху выхлопных газов или излишнему расходу топлива и масла.

Из-за того что количество вредных выбросов при таком ремонте не соответствует заявленным нормам, автомобиль может не пройти техосмотр. По российскому законодательству катализатор — компонент транспортного средства, поэтому автовладелец удаляет его на свой страх и риск. Если по каким-то причинам нужно заменить оригинальный катализатор, то установка универсального — оптимальное решение.

Не советую удалять катализатор на гарантийных автомобилях на пробеге до 100 000 км без необходимости. Двигатель автомобиля, скорее всего, снимут с гарантии из-за вмешательства в выхлопную систему. На гарантийных авто проблема с катализаторами возникает редко, менее 1% случаев от общего объема продаж.

Диагностическое оборудование расшифровало ошибку Check engine на приборной панели. Проблема в катализаторе

Почему катализаторы воруют

От краж катализатора часто страдают автомобили каршеринга и такси. Но были случаи, когда оригинальный катализатор вырезали на улице, когда автомобиль припаркован на ночь во дворе. Достаточно поднять машину домкратом и вырезать часть глушителя болгаркой.

В автомобилях с высоким клиренсом можно добраться до катализатора даже без домкрата. Кража катализатора занимает около минуты. Но если сигнализация оборудована датчиком наклона, то она сообщит, что автомобиль пытаются приподнять.

Таким варварским способом крадут катализаторы: просто вырезают его болгаркой. Источник: Константин Гахов / «Вконтакте»

Катализатор также могут вырезать в недобросовестном автосервисе. Владельцу предлагают «прочистить» выхлопную систему или удалить исправный катализатор, чтобы в будущем он не доставил проблем. Работники таких автосервисов еще рассказывают о преимуществах удаления катализатора: обещают, что мощность двигателя возрастает, а расход топлива снизится — ЭБУ шьют под Евро-2. Если оценить реальное увеличение мощности на специальном оборудовании, прирост будет незначительным — всего 3% от первоначальных показателей.

Обычно за удаление катализатора, установку пламегасителя, обманки или перепрошивки электронного блока управления автосервисы не берут никакой оплаты, а просто оставляют отработавший катализатор себе.

Но немало и тех, кто просто забирает молча, без всяких скидок и выплат, как лом черного металла. А потом сдают его, ведь оригинальный катализатор содержит драгоценные металлы, которые стоят дороже золота.

В среднем драгметаллы — это 0,08—0,17% от общей массы катализатора. Со временем он вырабатывает свой ресурс и драгметаллов становится меньше. Точное количество платины, палладия и родия в конкретном катализаторе определяют анализатором драгоценных металлов.

Если просят заплатить за удаление катализатора, установку пламегасителя, то катализатор рекомендую оставить себе. Ценность представляет не только целый катализатор, но и разрушенный, его лом, крошка и даже пыль. За изношенный катализатор современного автомобиля стандарта Евро-5 можно получить от 5000 Р. Чем мощнее двигатель авто, чем больше он расходует топлива, тем лучше, а значит, дороже его катализатор.

Цена платины, палладия и родия за грамм в рублях. Эти металлы, скорее всего, есть в оригинальном катализаторе автомобиля с бензиновым двигателем

Из-за чего катализатор выходит из строя

Износ напыления из драгоценных металлов. Драгоценные металлы на стенках ячеек катализатора выгорают — это естественный процесс. Поэтому при приеме катализатора на переработку проводят его химический анализ. Может оказаться так, что в катализаторе совсем не осталось драгметаллов. Когда это происходит, выхлопные газы перестают очищаться, кислородные датчики это фиксируют, и на панели приборов возникает ошибка.

Некачественное топливо. Иногда, чтобы увеличить октановое число топлива, недобросовестные владельцы заправок добавляют в него присадки, которые содержат свинец. Это увеличивает нагрузку на катализатор, соты забиваются продуктами горения топлива, и он раньше выходит из строя. Для дизельных двигателей повышенный износ сажевого фильтра происходит зимой, когда в топливо добавляют антигель.

Неисправности зажигания. Если свечи дают искру с перебоями, то несгоревшие остатки топливно-воздушной смеси сгорают в катализаторе, что уменьшает срок его службы. Соты катализатора при этом оплавляются, и его пропускная способность уменьшается.

Неисправности двигателя. Если в цилиндрах двигателя есть царапины или задиры, то смесь, которая получается при работе двигателя внутреннего сгорания, перестает быть двухкомпонентной — то есть теперь состоит не только из воздуха и топлива. В ней есть еще и моторное масло. Это неизбежно засоряет катализатор, и он вскоре выходит из строя. Часто в проблемах с двигателем обвиняют разрушившийся катализатор. Но в этом случае скорее двигатель провоцирует проблемы с катализатором.

Неисправный катализатор может оплавиться, разрушиться, у него могут забиться соты. Источник: LuYago / Shutterstock

Как обнаружить проблему

Катализатор редко разрушается внезапно, в один момент. Обычно этому предшествуют типичные симптомы работы двигателя, выхлопной системы и посторонние звуки. Если внимательно анализировать все изменения, можно вовремя вмешаться и исправить ситуацию.

Лампочка «чек энджин» на панели приборов загорается по разным причинам. Если считать код специальным сканером, то он покажет, где конкретно возникла проблема. Ошибка воздушных датчиков катализатора говорит о том, что с катализатором что-то не так.

Снижение мощности двигателя. По ощущениям за рулем это похоже на прицеп или машину на буксире. Автомобиль трогается с места, ускоряется, но ему как будто что-то мешает — ускорение недостаточно энергичное. Иногда двигатель машины при этом вибрирует, а сама машина дергается.

Посторонние звуки под днищем. Если катализатор уже начал разрушаться, то его частички при высоких оборотах двигателя или при запуске бьются о корпус выхлопной системы. При этом водитель слышит посторонние звуки под днищем автомобиля. Они похожи на звенящий звук в пустой металлической банке.

Нестабильный напор газов из глушителя. Для такой проверки нужно поднести руку к выхлопной трубе и почувствовать такт выхода газов. При нормальной работе газы выходят через равные промежутки времени, похожие на биение сердца. Если поток газов ровный и слабый, значит, катализатор, скорее всего, неисправен.

Запах выхлопных газов. Если катализатор не очищает выхлопные газы от токсичных выбросов, то это можно почувствовать без специальных замеров уровня углекислого газа. Рядом с машиной, особенно в момент ее прогрева, будет неприятно пахнуть продуктами сгорания топливно-воздушной смеси. Иногда запах проникает в салон автомобиля, когда двигатель работает на холостых оборотах.

Задиры на цилиндрах. Если катализатор уже начал разрушаться и его частицы попали в камеру сгорания топливно-воздушной смеси, то на цилиндрах образуются задиры и царапины. Проверку их состояния можно провести в автосервисе специальным устройством — эндоскопом. Если с цилиндрами все в порядке и нет других признаков, то удалять катализатор не нужно.

Проверка эндоскопом. Можно запустить эндоскоп через отверстие для первого лямбда-зонда. Керамические соты должны быть правильной формы, без вмятин, не оплавлены, не разрушены и не забиты. Мы уже разобрались, что второй кислородный датчик стоит после катализатора, а значит, смотреть там не на что: велика вероятность, что на выходе соты будут в полном порядке.

Диагностика датчиков. С помощью автосканера, например ELM 327, можно подключиться к электронному блоку управления автомобилем. В приложениях для смартфона нужно выбрать показания кислородных датчиков катализатора и сравнить их фактические значения с эталонными.

Проверять датчики нужно на прогретом, работающем на холостых оборотах двигателе. Отклонения от нормы будут означать, что катализатор неисправен. Хотя бывает и так, что дело во втором кислородном датчике — они со временем прогорают и перестают работать, так что нелишним будет совместить этот способ с проверкой эндоскопом.

Проверка катализатора эндоскопом показывает, что разрушений сот нет Скриншот приложения для сканера ELM 327. Проверил кислородные датчики своей машины — Хендай Креты. Как читать эти графики — узнал из ролика на «Ютубе». Верхний график отражает показания кислородного датчика до катализатора, а нижний — после него

Запомнить

  1. Катализатор — это важная деталь выхлопной системы, которая очищает отработавшие газы от вредных выбросов.
  2. При неисправном катализаторе двигатель теряет мощность, в выхлопной системе появляются посторонние звуки, а отработавшие газы неприятно пахнут.
  3. Катализатор выходит из строя раньше срока из-за некачественного топлива, неисправностей зажигания и двигателя.
  4. Обнаружить проблему поможет диагностика ЭБУ автосканером или визуальная проверка цилиндров и катализатора эндоскопом.
  5. Оригинальный катализатор содержит драгоценные металлы, поэтому он такой дорогой.
  6. Если нужно заменить отработавший оригинальный катализатор, есть смысл поставить универсальный.
  7. Установка пламегасителей, обманок и перепрошивка ЭБУ может привести к проблемам с двигателем.
  8. Не стоит удалять катализатор без необходимости на гарантийных автомобилях.
  9. За работу по удалению катализатора можно расплатиться старым катализатором. Платить за работу и оставлять катализатор в сервисе как лом — все равно что дарить деньги.
  10. Недобросовестные автосервисы предлагают удалить катализатор, чтобы сдать его и заработать.

Двухкомпонентная вакцина с наночастицами, демонстрирующая гликозилированный спайковый домен S1, индуцирует нейтрализующий ответ антител против вариантов SARS-CoV-2

Вакцины прокладывают путь к пандемии SARS-CoV-2. Помимо мРНК и аденовирусных векторных вакцин, необходимы эффективные белковые вакцины для иммунизации против существующих и новых вариантов. Мы разработали вакцину на основе вирусоподобных частиц (VLP), используя систему экспрессии бакуловирусных клеток и клеток насекомых, надежную производственную платформу, известную своей масштабируемостью, низкой стоимостью и безопасностью.Были сконструированы бакуловирусы, кодирующие белки-шипы SARS-CoV-2: полноразмерный S, стабилизированный секретируемый S или домен S1. Поскольку субъединица S только частично защищала мышей от заражения SARS-CoV-2, мы продуцировали S1 для конъюгации с наночастицами VLP бактериофага AP205 с использованием технологии tag / catcher. Выход S1 в биореакторе из клеток насекомых составлял ~ 11 мг / л, и были подтверждены аутентичный фолдинг белка, эффективное гликозилирование, частичная тримеризация и связывание рецептора ACE2. Прайм-буст иммунизация мышей 0.5 мкг S1-VLP показали мощные нейтрализующие реакции антител против вариантов SARS-CoV-2 из Ухани и UK / B.1.1.7. Эта двухкомпонентная вакцина с наночастицами теперь может быть доработана, чтобы помочь облегчить бремя COVID-19. ВАЖНОСТЬ Вакцинация необходима для снижения тяжести заболевания и ограничения передачи коронавируса 2 (SARS-CoV-2) тяжелого острого респираторного синдрома. Вакцины на основе белков полезны для вакцинации населения мира и повышения иммунитета против появляющихся вариантов.Их профили безопасности, стоимость производства и температура хранения вакцины выгодны по сравнению с мРНК и векторными вакцинами аденовируса. Здесь мы используем универсальную и масштабируемую систему векторов экспрессии бакуловируса для создания двухкомпонентной вакцины с наночастицами, чтобы вызвать мощные нейтрализующие ответы антител против вариантов SARS-CoV-2. Эти вакцины с наночастицами можно быстро адаптировать в качестве бустеров путем простого обновления антигенного компонента.

Ключевые слова: SARS-CoV-2; клетки насекомых; наночастица; вакцина.

Иммунофокусирование и усиление аутологичной нейтрализации ВИЧ-1 уровня 2 путем отображения тримеров Env на двухкомпонентных белковых наночастицах

Дизайн конструкции

Немеченая конструкция 16055 SOSIP.v5.2 была создана путем переваривания плазмиды pPPI4 с помощью PstI и NotI и замена ранее описанного BG505 SOSIP.v5.2 на упорядоченную последовательность 16055 (Genbank: EF117268.1 [https://www.ncbi.nlm.nih.gov/nuccore/EF117268.1]; Integrated DNA Technologies), которая имела Сайт расщепления фурином (REKR) заменен на RRRRRR и введены следующие мутации: H66R, A73C, T316W, A501C, I559P, A561C и T605C.Для создания конструкции 16055 SOSIP.v8.3-I53-50A была заказана модифицированная последовательность 16055 SOSIP.v5.2 (Integrated DNA Technologies) и клонирована сборкой Гибсона в ранее описанную плазмиду I53-50A, которая была расщеплена с использованием PstI и БамГИ 27 . Модификация состояла из следующих ранее описанных мутаций: E47D, K49E, V65K, I165L, E429R, R432Q, A500R (мутации TD8 32 ), R304V, A319Y, S363Q, I519S, L568D, V570H, R585H (мутации MD39 8 ) и T569G 7 .Для создания немеченой конструкции 16055 SOSIP.v8.3 стоп-кодон вводили непосредственно после С-концевого остатка 664. Для Ni-NTA ELISA и SPR-экспериментов, меченые His версии 16055 SOSIP.v8.3 были созданы путем добавления аминокислотной последовательности GSGSGGSGHHHHHHHH сразу после C-концевого остатка 664 тримера.

Экспрессия и очистка белка Env

Все конструкции 16055 экспрессировали в временно трансфицированных клетках HEK293F (Invitrogen, кат.R79009) поддерживали в среде Freestyle (Life Technologies) с использованием ранее описанных методов 38,49 . Вкратце, смесь 3: 1 PEImax (1 мкг / мкл; 937,5 мкг / л клеток) и экспрессионных плазмид (312,5 мкг / л клеток) добавляли до 0,8–1,2 миллиона клеток / мл. Чтобы гарантировать оптимальное фурин-опосредованное расщепление компонента Env, клетки трансфицировали (1) плазмидой Env и фурином в соотношении 4: 1 для конструкций SOSIP или (2) соотношением плазмиды Env и фурина для SOSIP- 3: 1. Конструкции I53-50A. Белки очищали с помощью вакуум-фильтрации (0.22 мкм фильтры) супернатанты трансфекции с помощью PGT145 bNAb-аффинной хроматографии. Гранулы сефарозы, связанной с PGT145, смешивали с отфильтрованным супернатантом и после инкубации в течение ночи на валике промывали и элюировали, как описано ранее 49 . Белковые элюаты концентрировали и буфер заменяли на TN75 (75 мМ NaCl, 20 мМ Tris HCl pH 8,0) с использованием фильтров Vivaspin с отсечкой по молекулярной массе 100 кДа (GE Healthcare). Концентрацию белка определяли методом Nanodrop.Требуемый пептидный молекулярный вес белков и коэффициент экстинкции были получены путем заполнения аминокислотной последовательности белка в онлайн-программе Expasy (инструмент ProtParam).

Экспрессия и очистка белков I53-50B.4PT1 и I53-50A

Белки I53-50A и I53-50B.4.PT1 экспрессировались, как недавно описано 45 . Вкратце, клетки Lemo21 (DE3) (NEB), которые выращивали в LB (10 г триптона, 5 г дрожжевого экстракта, 10 г NaCl) в 2-литровых встряхиваемых колбах с перегородками или 10-литровом ферментере BioFlo 320 (Eppendorf), использовали для экспрессии I53-50A или I53-50B.Белки 4PT1 выросли. Клетки индуцировали 1 мМ IPTG и встряхивали в течение ~ 16 ч при 18 ° C. Микрофлюидизацию использовали для сбора и лизирования клеток с использованием аппарата Microfluidics M110P при 18000 фунтов на кв. Дюйм в 50 мМ Трис, 500 мМ NaCl, 30 мМ имидазол, 1 мМ PMSF, 0,75% CHAPS. Белки очищали нанесением осветленных лизатов на колонку 2,6 × 10 см Ni Sepharose 6 FF (Cytiva) на системе AKTA Avant150 FPLC (Cytiva). Линейный градиент от 30 мМ до 500 мМ имидазола в 50 мМ Трис, pH 8, 500 мМ NaCl, 0.Для элюирования обоих белков использовали 75% CHAPS. Затем объединенные фракции подвергали эксклюзионной хроматографии на колонке Superdex 200 Increase 10/300 или HiLoad S200 pg GL SEC (Cytiva) в 50 мМ Tris pH 8, 500 мМ NaCl, 0,75% буфере CHAPS. I53-50A элюируется при объеме колонки ~ 0,6 (CV), тогда как I53-50B.4PT1 элюируется при ~ 0,45 CV. Перед сборкой наночастиц были протестированы белковые препараты, чтобы подтвердить низкий уровень эндотоксина.

Сборка I53-50NP

Для создания голых частиц I53-50NP конечная концентрация 50 мкМ очищенного I53-50A и 50 мкМ I53-50B.4PT1 в 25 мМ Трис pH 8, 500 мМ NaCl, 0,75% CHAPS инкубировали при комнатной температуре в течение по крайней мере 1 ч при осторожном покачивании. Затем сборочную смесь стерильно фильтровали (фильтры 0,22 мкм) и наносили на колонку Superose 6 с увеличением 10/300 GL (GE Healthcare) для удаления несобранных компонентов. Хорошо упорядоченные наночастицы элюируются в объеме 11,5 мл.

SOSIP-I53-50NP в сборе

16055 SOSIP-I53-50NP были произведены, как описано недавно 27 . Вкратце, очищенный PGT145 16055 SOSIP-I53-50A подвергали эксклюзионной хроматографии с использованием колонки Superose 6 Increase (GE Healthcare) в буфере сборки II (25 мМ Трис, 500 мМ NaCl, 5% глицерин, pH 8.2) для удаления агрегированных белков. Фракции колонки, не содержащие агрегированных тримеров, затем немедленно объединяли и смешивали в эквимолярном соотношении с I53-50B.4PT1 с последующей стадией инкубации в течение ночи при 4 ° C. Сборочную смесь концентрировали при 350 × г с использованием фильтров Vivaspin (отсечение молекулярной массы 10 кДа; GE Healthcare) и подвергали еще одному раунду эксклюзионной хроматографии с использованием той же колонки и буфера для удаления несобранных компонентов. Фракции, соответствующие собранным наночастицам (элюирование между 8.5–10,5 мл с пиком 9 мл) были объединены и сконцентрированы до 350 × g центрифугированием с фильтрами Vivaspin (отсечение молекулярной массы 10 кДа; GE Healthcare). Затем буферы 16055 SOSIP-I53-50NP заменяли на PBS с добавлением 250 мМ сахарозы с использованием диализного устройства Slide-A-Lyzer MINI (отсечка молекулярной массы 20 кДа; ThermoFisher Scientific). Концентрации наночастиц определяли методом Nanodrop с использованием пептидной молекулярной массы и коэффициента экстинкции.

Анализ SDS-PAGE и BN-PAGE

SDS-PAGE и BN-PAGE выполняли, как описано ранее 38 .Вкратце, для SDS-PAGE 2 мкг тримеров SOSIP или 3,2 мкг тримеров SOSIP-I53-50NP (что эквивалентно 2 мкг тримеров) наносили на 4–12% гель трис-глицина или 6–18% трис- Глициновый гель (оба от Invitrogen). Для BN-PAGE такие же количества тримеров SOSIP и SOSIP-I53-50NP загружали в 4–12% гель Bis-Tris NuPAGE или 3–12% гель Bis-Tris NuPAGE (оба от Invitrogen), соответственно.

Биослойная интерферометрия

Концентрация mAb 10 мкг / мл в рабочем буфере (PBS, 0,02% Tween20, 0.1% BSA) загружали на биосенсоры ProtA с использованием Octet K2 (ForteBio). После погружения чипа в рабочий буфер для удаления избытка mAb, чип погружали на 600 с в лунку, содержащую 100 мкМ 16055 SOSIP.v5.2 или 16055 SOSIP.v8.3 в рабочем буфере для измерения ассоциации. Наконец, чип погружали на 300 с в рабочий буфер для измерения диссоциации.

Дифференциальная сканирующая флуориметрия

Prometheus NT.48 Инструмент NanoDSF (NanoTemper Technologies) использовался для всех экспериментов по определению T m , как описано ранее 27 .Образцы тримеров SOSIP и SOSIP-I53-50NP (в трех экземплярах) разбавляли до 0,35 мг / мл в TBS и загружали в капилляры NanoDSF. Температуру повышали от 20 до 95 ° С со скоростью 1 ° С / мин. Программное обеспечение прибора использовалось для расчета 1-й производной кривой, а положение максимума было принято как значение T м .

Поверхностный плазмонный резонанс

Поверхностный плазмонный резонанс (SPR) использовался для оценки структурной целостности 16055 SOSIP.v8.3 тримеры на поверхности I53-50NP, как описано в другом месте 27 . Все эксперименты проводились на приборе BIAcore 3000 (Cytiva, ранее GE Healthcare) при 25 ° C с HBS-EP (0,01 M HEPES, 0,15 M NaCl, 3 мМ EDTA, 0,005% об. / Об. Поверхностно-активное вещество P20, pH 7,4) в качестве рабочий буфер.

Сенсорные чипы

C1 использовали для иммобилизации His-меченного тримера и наночастиц с помощью антител против гистидина (Cytiva). Вкратце, поверхность сенсора С1 была предварительно промыта антителом против гистидина (разбавленным до 50 мкг / мл в Na-ацетате, pH 4.5) связывали амином во всех проточных ячейках, следуя протоколу связывания стандарт-амин, с получением плотностей ~ 1500 RU. Тримеры и наночастицы иммобилизовали в параллельных проточных ячейках при средней плотности 224 ± 0,862 RU (sem) и 316 ± 0,961 RU, чтобы получить такое же количество Env (то есть для контроля дополнительной массы наночастиц, отличной от Env, также 27 ). Одна проточная кювета служила фоновым контролем для неспецифического связывания. Для анализа связывания 1 мкМ каждого mAb позволяли связываться в течение 300 с и диссоциировать в течение 300 с при скорости потока 30 мкл / мин.В конце каждого цикла связывания поверхность сенсора регенерировали с использованием одного импульса 10 мМ глицина (pH 2,0) при скорости потока 75 мкл / мин. Каждое mAb анализировали в двойных циклах. Сенсограммы представлены после вычитания неспецифического связывания в контрольной проточной ячейке (которое было <1%).

Сайт-специфический анализ гликанов с использованием масс-спектрометрии

Белки Env денатурировали в течение 1 часа в 50 мМ трис / HCl, pH 8,0, содержащем 6 М мочевины и 5 мМ дитиотреитол (DTT).Белки Env восстанавливали и алкилировали добавлением 20 мМ йодацетамида (ИУК) и инкубировали в течение 1 часа в темноте с последующей 1-часовой инкубацией с 20 мМ DTT для удаления остаточной ИУК. Буфер алкилированных белков Env заменяли на 50 мМ Трис / HCl, pH 8,0 с использованием колонок Vivaspin (3 кДа) и расщепляли отдельно в течение ночи с использованием трипсина или химотрипсина (Mass Spectrometry Grade, Promega) в соотношении 1:30 (мас. / Мас.) . Пептиды сушили и экстрагировали с помощью наконечника C18 Zip-tip (MerckMilipore). Пептиды снова сушили, ресуспендировали в 0.1% муравьиной кислоты и анализируется с помощью наножидкостной хроматографии, электрораспылительной ионизации и масс-спектрометрии (LC-ESI MS) с системой Easy-nLC 1200 (Thermo Fisher Scientific), соединенной с масс-спектрометром Fusion (Thermo Fisher Scientific) с использованием более высокой энергии, индуцированной столкновениями диссоциация (HCD) фрагментация. Пептиды разделяли с использованием колонки EasySpray PepMap RSLC C18 (75 мкм x 75 см). Условия жидкостной хроматографии были следующими: 275-минутный линейный градиент, состоящий из 0–32% ацетонитрила в 0 ° С.1% муравьиная кислота в течение 240 минут, затем 35 минут 80% ацетонитрил в 0,1% муравьиной кислоте. Скорость потока была установлена ​​на 200 нл / мин. Напряжение распыления устанавливали на 2,7 кВ, а температуру нагретого капилляра устанавливали на 40 ° C. Температура трубки для переноса ионов была установлена ​​на 275 ° C. Диапазон сканирования 400–1600 m / z. Энергия столкновения HCD была установлена ​​на 50%, что подходит для фрагментации ионов гликопептида. Обнаружение прекурсоров и фрагментов выполняли с помощью орбитальной ловушки с разрешением MS1 = 100000. MS2 = 30 000.Целевое значение AGC для MS1 = 4e5 и MS2 = 5e4 и времени впрыска: MS1 = 50 мс MS2 = 54 мс.

Данные о фрагментации гликопептидов были извлечены из необработанного файла с помощью Byos (версия 3.9; Protein Metrics Inc.). Данные о фрагментации гликопептидов оценивали вручную для каждого гликопептида; пептид оценивался как истинно-положительный, когда наблюдались правильные ионы b- и y-фрагментов вместе с ионами оксония, соответствующими идентифицированному гликану. Относительные количества каждого гликана в каждом сайте, а также незанятую долю определяли путем сравнения выделенных хроматографических областей для различных гликотипов с идентичной пептидной последовательностью.Допуск по массе предшественника был установлен на уровне 4 частей на миллион для MS1 и 10 частей на миллион для фрагментов MS2. Был применен коэффициент ложного обнаружения 1%. Относительные количества каждого гликана в каждом сайте, а также незанятую долю определяли путем сравнения выделенных ионно-хроматографических областей для различных гликопептидов с идентичной пептидной последовательностью.

Для получения данных для сайтов, которые часто представляют гликопептиды низкой интенсивности, гликаны, присутствующие на гликопептидах, гомогенизировали для повышения интенсивности этих пептидов.Этот анализ теряет точную информацию обработки, но позволяет определить соотношение олигоманноза: комплекс: незанятые. Оставшиеся гликопептиды сначала расщепляли Endo H (New England Biolabs) для истощения гликанов олигоманнозного и гибридного типа и оставления единственного остатка GlcNAc в соответствующем сайте. Затем реакционную смесь полностью сушили и ресуспендировали в смеси, содержащей 50 мМ бикарбоната аммония и PNGase F (New England Biolabs), используя только h3O 18 (Sigma-Aldrich).Эта вторая реакция расщепляет оставшиеся гликаны сложного типа, но оставляет остатки GlcNAc, оставшиеся после расщепления Endo H, нетронутыми. Использование h3O 18 в этой реакции позволяет дифференцировать сложные гликановые сайты от незанятых гликановых сайтов, поскольку гидролиз гликозидной связи PNGaseF оставляет тяжелый изотоп кислорода на образующемся остатке аспарагиновой кислоты. Полученные пептиды очищали, как описано выше, и подвергали обращенно-фазовой наноЖХ-МС. Вместо использованной выше обширной библиотеки N-гликанов был проведен поиск двух модификаций: +203 Да, соответствующего одному GlcNAc, остатку гликана олигоманнозы / гибридного гликана, и +3 Да, соответствующему продукту деамидирования O 18 сложный гликан.Использовали более низкую энергию HCD 27%, поскольку фрагментация гликана не требовалась. Анализ данных выполняли, как указано выше, и определяли относительные количества каждой гликоформы, включая незанятые пептиды. Данные двух серий экспериментов были объединены, и гликаны сгруппированы в соответствии с присутствием гликанов с высоким содержанием маннозы, соответствующих гликанам гибридного и олигоманнозного типов, гликанам сложного типа и незанятым PNGS.

ЭМ с отрицательным окрашиванием

Эксперименты по электронной микроскопии с отрицательным окрашиванием (nsEM) проводили, как описано ранее 27,28 .Все образцы (свободные тримеры или собранные наночастицы) разбавляли до 20–50 мкг / мл и наносили на покрытые углеродом медные сетки (400 меш, тлеющий разряд при 15 мА в течение 30 с). Образец промокали фильтровальной бумагой, а затем сетки отрицательно окрашивали 2% (мас. / Об.) Уранилформиатом в течение 60 с. Данные были собраны на электронном микроскопе Tecnai F20, работающем при 200 кэВ. Номинальное увеличение составляло 62000 с результирующим размером пикселя 1,77 Å в плоскости образца. Расфокусировка составляла -1,50 мкм.Для получения изображений использовалась CMOS-камера Tietz 4k × 4k TemCam-F416. Сбор данных выполнялся с использованием автоматизированного интерфейса визуализации Leginon 50 . Первоначальная обработка данных была выполнена с использованием пакета обработки данных Appion 51 . Для образцов SOSIP-I53-50NP примерно ~ 1000 частиц были вручную выбраны из микрофотографий и подвергнуты итеративному алгоритму MSA / MRA для 2D-классификации. Для бесплатных тримеров 16055 SOSIP ~ 20 000 частиц были автоматически отобраны и классифицированы в 2D.

Поколение PGDM1400, VRC26.25, В-клетки, экспрессирующие PGT121, VRC01 и RM19R

Для создания В-клеток, стабильно экспрессирующих Env-специфические BCR, IgM-отрицательные В-клетки Ramos 52 по существу подвергали лентивирусной трансдукции. Лентивирусы получали путем котрансфекции флакона T25 с Т-клетками HEK 293 плазмидами pMDL (1,5 мкг), pVSV-g (0,83 мкг) и pRSV-Rev (0,6 мкг) и BCR-кодирующей B-клеточной специфической плазмидой. pRRL EuB29 gl2-1261 IgGTM.BCR.GFP.WPRE 53 (2,4 мкг) с использованием липофектамина 2000 (Invitrogen).Перед получением лентивируса ген gl2-1261 был заменен сборкой Гибсона с упорядоченными генами тяжелой и легкой цепей зрелых PGDM1400, VRC01, PGT121, VRC26.25 и RM19R (Integrated DNA Technologies). Через два дня после трансфекции супернатанты, содержащие лентивирусные частицы, фильтровали (0,45 мкм) и концентрировали до 200 мкл с использованием фильтров Vivaspin с использованием фильтров Vivaspin с отсечкой по молекулярной массе 100 кДа (GE Healthcare). Затем IgM-отрицательные B-клетки Ramos 52 , культивированные в RPMI с добавлением 10% фетальной телячьей сыворотки, пенициллина (100 Ед / мл) и стрептомицина (100 мкг / мл), трансдуцировали концентрированным вирусным супернатантом.Через семь дней после трансдукции дважды положительные по GFP и IgG клетки (т.е. клетки, экспрессирующие BCR) сортировали на FACS ARIA-II SORP (BD Biosciences) и культивировали.

Эксперименты по активации B-клеток

Эксперименты по активации B-клеток Ramos B-клеток, стабильно экспрессирующих BCR VRC01, VRC26.25, PGDM1400, PGT121 или RM19R, проводили, как описано ранее 27,49 . Вкратце, экспрессирующие BCR B-клетки Ramos суспендировали при концентрации 4 млн клеток / мл в RPMI + + и метили 1,5 мкМ Indo-1 (Invitrogen) в течение 30 минут при 37 ° C.Затем клетки промывали солевым раствором Hank’s Balance, содержащим 2 мМ CaCl 2 , и инкубировали еще 30 мин при 37 ° C. Приток В-клеток Ca 2+ контролировали путем измерения коэффициента эмиссии 379/450 нм на LSR Fortessa (BD Biosciences). После 30 секунд измерения исходного уровня аликвоты 1 миллион клеток / мл затем стимулировали в течение 100 секунд при комнатной температуре 5 или 50 мкг / мл 16055 SOSIP или эквимолярным количеством, представленным на I53-50NP. Для определения максимального притока Ca 2+ использовали иономицин 1 мг / мл (Invitrogen).Кинетические анализы были выполнены с использованием FlowJo v10.7.

Иммунизация кроликов

Самок и наивных новозеландских белых кроликов (2,5–3 кг) произвольно распределяли по группам (по 5 кроликов в группе), поставили и разместили в Covance Research Products Inc. (Денвер, Пенсильвания, США). Иммунизация проводилась с соблюдением всех соответствующих этических норм для испытаний и исследований на животных. Исследование получило этическое одобрение Комитета по уходу и использованию животных Covance с номером одобрения C0038-19.Кролики получали внутримышечную иммунизацию в каждый квадрицепс на 0, 4 и 20 неделе. Смеси для иммунизации состояли из 30 мкг тримеров 16055 SOSIP.v8.3 или эквимолярного количества, представленного на I53-50NP (48 мкг), приготовленных в адъюванте адъюплекс (Empirion ). Расчеты дозы основывались на пептидной молекулярной массе белков, которая была получена путем заполнения аминокислотной последовательности белка в онлайн-программе Expasy (инструмент ProtParam). У кроликов брали кровь в день иммунизации и на 2, 6, 12 и 22 неделях.

Выделение IgG и очистка Fab

Для очистки поликлонального кроличьего IgG 1 мл кроличьей сыворотки инкубировали в течение ночи с 250 мкл агарозных гранул с протеином G (ThermoScientific). На следующий день IgG элюировали 0,1 М глицином, pH 2,5, после чего буфер для элюции нейтрализовали 2 М Трис, pH 8,0. После концентрирования и замены буфера на PBS с помощью фильтров Vivaspin (отсечение молекулярной массы 10 кДа; GE Healthcare) концентрации IgG измеряли с использованием метода Nanodrop.Затем для создания Fab очищенный IgG инкубировали при встряхивании с иммобилизованной папаиновой смолой (ThermoScientific; 100 мкл смолы / мг IgG) в течение 5 часов при 37 ° C в фосфатном буферном солевом растворе, 10 мМ EDTA, 20 мМ цистеина, pH 7,4. . Через 5 ч смолу удаляли центрифугированием на центрифуге с использованием центрифужных трубчатых фильтров Spin-X ® (Corning Inc.). Затем проточную смесь инкубировали с агарозной смолой с протеином A (ThermoScientific; 200 мкл смолы / мг Ig) в течение 2 часов, встряхивая при комнатной температуре для удаления Fc и непереваренных IgG.После удаления смолы центрифугированием в центрифуге с использованием центрифужных фильтров Spin-X ® (Corning Inc.) проточный буфер заменяли на PBS и концентрировали с использованием фильтров Vivaspin (отсечка по молекулярной массе 10 кДа; GE Healthcare).

EMPEM анализ

Очищенные поликлональные образцы Fab были объединены в комплекс с антигеном 16055 SOSIP.v8.3. Для каждой реакции 200 мкг поликлонального Fab (при 1 мг / мл) инкубировали с 15 мкг антигена (при 1,4 мг / мл) в течение 16–20 ч (RT). Впоследствии все образцы подвергали SEC (столбец Superose 6 Increase, TBS в качестве рабочего буфера).Фракции, соответствующие иммунным комплексам, объединяли и концентрировали с помощью устройств для ультрафильтрации Amicon (отсечение молекулярной массы 10 кДа; MerckMillipore). Концентрированные комплексные образцы разбавляли до 100 мкг / мл и наносили на покрытые углеродом медные сетки (400 меш, тлеющий разряд при 15 мА в течение 25 с перед нанесением образца). Для промокания образцов использовали фильтровальную бумагу, а затем сетки окрашивали 2% (мас. / Об.) Уранилформиатом в течение 60 с.

Визуализацию сетки выполняли, как описано выше в разделе, посвященном методам электронной микроскопии с отрицательным окрашиванием, и с использованием того же оборудования для микроскопии.Пакет обработки данных Appion применялся для этапов автоматического отбора и извлечения частиц 51 . Затем 120 000–200 000 частиц классифицируются в 2D на 250 классов (50 итераций) с помощью Relion 3.0 54 . Частицы из классов со сложными характеристиками (~ 60–90% набора данных после извлечения) были выбраны для 3D-классификации в Relion 3.0. В качестве исходной модели для этапов трехмерной классификации и уточнения использовалась карта с низким разрешением не связанного лигандами Env-эктодомена ВИЧ. Для первоначальной 3D-классификации использовалось 40 классов.Затем частицы из похожих на вид классов были объединены и подвергнуты одному или нескольким дополнительным циклам 3D-классификации. 3D-классы с уникальными структурными особенностями (с точки зрения связанных поликлональных Fab) были подвергнуты 3D-автоматическому уточнению в Relion 3.0. Уточненные трехмерные карты были загружены в UCSF Chimera 1.13 для визуализации, сегментации и подготовки рисунков 55 . После первоначального этапа двухмерной классификации для частиц также было выполнено трехмерное уточнение, и эти уточненные модели были отправлены в EMDB (по 1 для каждого набора данных; см. Доступность данных).

ELISA сывороточных антител

6,5 нМ меченного His тример 16055 SOSIP.v8.3 в TBS добавляли в 96-луночный планшет Ni-NTA (Qiagen) на 2 часа при комнатной температуре. Планшеты блокировали на 30 мин TBS / 2% обезжиренного молока. Трехкратные серийные разведения кроличьей сыворотки, начиная с разведения 1: 100 (недели 0,4, 6, 12, 20) или разведения 1: 1000 (неделя 22), добавляли в TBS / 2% обезжиренное молоко / 20%. овечья сыворотка в течение 2 ч инкубации при комнатной температуре. Разведение 1: 3000 меченного HRP козьего антикроличьего IgG (Jackson Immunoresearch) в TBS / 2% обезжиренном молоке добавляли на 1 час при комнатной температуре.Между каждым этапом планшеты трижды промывали TBS. Наконец, после пятикратной промывки планшетов смесью TBS / 0,05% Tween-20 проявляющийся раствор (1% 3,3 ‘, 5,5’-тетранэтилбензидин (Sigma-Aldrich), 0,01% h3O2, 100 мМ ацетат натрия и 100 мМ лимонная кислота). Развитие колориметрической конечной точки продолжалось в течение 1 мин перед завершением путем добавления 0,8 М h3SO4. Ту же процедуру использовали для измерения титров связывающих антител против немодифицированного I53-50NP, за исключением того, что концентрация покрытия I53-50NP составляла 3 нМ, а начальное разведение сыворотки составляло 1: 500.Титры связывания (значения ED 50 ) определяли как разведение сыворотки, которое давало 50% максимального ответа по сигмоидальной кривой.

Competition ELISA

Полулуночные 96-луночные планшеты покрывали в течение ночи при комнатной температуре лектином Galanthus nivalis (Vector Laboratories) в концентрации 20 мкг / мл в 0,1 М NaHCO. 3 pH 8,6. На следующий день планшеты промывали и добавляли блокирующий казеин буфер (ThermoScientific). Через 30 минут добавляли немаркированный 16055 SOSIP.v8.3 в концентрации 2 мкг / мл в казеине на 2 часа при комнатной температуре.Затем планшеты промывали и добавляли разведение 1: 100 кроличьей сыворотки в TBS / 2% обезжиренном молоке / 20% овечьей сыворотке на 30 мин. Затем mAb добавляли в течение 1,5 ч при комнатной температуре до конечной концентрации, которая давала 80% максимального сигнала связывания, как определено с помощью ELISA в отсутствие сыворотки (D11A.F9: 0,1 мкг / мл; D11A.F2: 0,1 мкг / мл. ; RM19R: 2 мкг / мл в TBS / 2% обезжиренном молоке / 20% овечьей сыворотке). Затем планшеты трижды промывали и добавляли разведение 1: 3000 меченного HRP ослиного античеловеческого IgG (Jackson Immunoresearch) в казеине на 1 час при комнатной температуре.Затем проводили промывку и колориметрическое детектирование, как описано выше для анализа сывороточных антител с помощью ELISA. Остаточное связывание определяли, как описано ранее 27 .

Анализ нейтрализации

Анализы нейтрализации выполняли, как недавно описано 49 . Вкратце, инактивированная нагреванием сыворотка в разведении 1:20 была серийно разбавлена ​​в 3 раза и смешана с Env-псевдотипированным вирусом. После 1 ч инкубации при комнатной температуре смесь добавляли к клеткам TZM-bl, которые были засеяны до плотности 17.000 клеток / лунка накануне. Через 72 часа клеточную среду удаляли, клетки лизировали и измеряли люциферазу с использованием набора Bright Glo Luciferase (Promega). Люциферазную активность измеряли с помощью планшет-ридера Glomax. Титры нейтрализации (значения ID 50 ) определяли как разведение сыворотки, при котором инфекционность подавлялась на 50%.

Статистический анализ

Сравнение двух групп кроликов проводилось с использованием двустороннего критерия Манна – Уитни U .Корреляции были проанализированы путем расчета коэффициентов ранговой корреляции Спирмена. Graphpad Prism 7.0 использовали для статистического анализа и определения значений ED 50 и ID 50 для сывороточных антител ELISA и анализов нейтрализации, соответственно.

Краткое изложение отчета

Дополнительная информация о дизайне исследования доступна в Резюме отчета по исследованию природы, связанном с этой статьей.

Ускользание от нейтрализующих антител спайк-вариантов белка SARS-CoV-2

ACE2 29clT / .22 рекомбинантной ДНК Праймер для ПЦР и секвенирования 18080093 Amplier Cat. A63881 90 412 Кат. № 7360 9019
Штамм, фон штамма (вирус везикулярного стоматита) VSV / SARS-CoV-2 / GFP 1D7 ; WT 1D7 Schmidt et al., 2020 Рекомбинантный химерный репортерный вирус VSV / SARS-CoV-2
Штамм, фон штамма (вирус везикулярного стоматита) rVSV / SARS-CoV-2 / GFP 2E1 ; WT 2E1 Schmidt et al., 2020 Рекомбинантный химерный репортерный вирус VSV / SARS-CoV-2
Штамм, фон штамма (вирус везикулярного стоматита) E484K 2E1 ., 2020, и этот документ мутантный rVSV / SARS-CoV-2 / производное GFP
Запросы следует направлять по адресу P.Bieniasz
Штамм, фон штамма (вирус везикулярного стоматита) Q493R 1D7 Schmidt et al., 2020, и эта статья мутант rVSV / SARS-CoV-2 / GFP Должен быть производным 902 / GFP. адресовано P.Bieniasz
Штамм, фон штамма (вирус везикулярного стоматита) R346S 1D7 Schmidt et al., 2020, и эта статья мутантный rVSV / производное SARS-CoV-2 / GFP
Запросы следует направлять по адресу: P.Bieniasz
Штамм, фон штамма (вирус везикулярного стоматита) R346 2E1 Schmidt et al., 2020, и эта статья мутантный rVSV / SARS-CoV-2 / GFP Запрос должен быть производным
адресовано P.Bieniasz
Штамм, фон штамма (вирус везикулярного стоматита) N440K 2E1 Schmidt et al., 2020, и эта статья мутантный rVSV / производное SARS-CoV-2 / GFP
Запросы следует направлять по адресу: P.Bieniasz
Штамм, фон штамма (вирус везикулярного стоматита) K444N 1D7 Schmidt et al., 2020, и эта статья мутант rVSV / SARS-CoV-2 / GFP адресовано P.Bieniasz
Штамм, фон штамма (вирус везикулярного стоматита) K444T 2E1 Schmidt et al., 2020, и эта статья мутантный rVSV / производное SARS-CoV-2 / GFP
Запросы следует направлять
на адрес П.Bieniasz
Штамм, фон штамма (вирус везикулярного стоматита) V445G 2E1 Schmidt et al., 2020, и эта статья мутант rVSV / SARS-CoV-2 / GFP адресовано P.Bieniasz
Штамм, фон штамма (вирус везикулярного стоматита) V445E 1D7 Schmidt et al., 2020, и эта статья мутантный rVSV / SARS-CoV-2 / GFP
Запросы следует направлять по адресу: P.Bieniasz
Штамм, фон штамма (вирус везикулярного стоматита) V445L 2E1 Schmidt et al., 2020, и эта статья мутант rVSV / SARS-CoV-2 / GFP адресован P.Bieniasz
Штамм, фон штамма (вирус везикулярного стоматита) N148S Schmidt et al., 2020, и эта статья мутантный rVSV / SARS-CoV-2 / GFP, производное
Запрос быть
на имя П.Bieniasz
Штамм, фон штамма (вирус везикулярного стоматита) K150R Schmidt et al., 2020, и эта статья мутант rVSV / SARS-CoV-2 / GFP, производное
Следует направлять запросы .Bieniasz
Штамм, фон штамма (вирус везикулярного стоматита) K150E Schmidt et al., 2020, и эта статья мутантный rVSV / SARS-CoV-2 / производное GFP
. П.Bieniasz
Штамм, фон штамма (вирус везикулярного стоматита) S151P Schmidt et al., 2020, и эта статья мутант rVSV / SARS-CoV-2 / GFP, производное
Следует направлять запросы .Bieniasz
Клеточная линия ( Homo sapiens ) Expi293F Клетки Thermo Fisher Scientific Cat # A14527
Клеточная линия ( H. sapiens 2). ATCC CRL-3216
Клеточная линия ( H.sapiens ) 293T / ACE2 (B) Schmidt et al., 2020 293 T-клетки, экспрессирующие человеческий ACE2 (основная популяция)
Клеточная линия ( H. sapiens ) Schmidt et al., 2020 293 Т-клетки, экспрессирующие человеческий ACE2 (одноклеточный клон)
Биологический образец ( H. sapiens ) COV-47 Robbiani et al., 2020 Образец плазмы человека
Биологический образец ( H.sapiens ) COV-72 Robbiani et al., 2020 Образец плазмы человека
Биологический образец ( H. sapiens ) COV-107 Robbiani et al. , 2020 Образец плазмы человека
Биологический образец ( H. sapiens ) COV-NY Luchsinger et al., 2020 Образец плазмы человека
Антитело C123
(человеческое моноклональное)
Robbiani et al., 2020 Эксперименты по селекции (10 мкг / мл, 5 мкг / мл)
Антитело C135
(человеческий моноклональный)
Robbiani et al., 2020 Эксперименты по селекции (10 мкг / мл, 5 мкг / мл)
Антитело C144
(человеческий моноклональный)
Robbiani et al., 2020 Эксперименты по селекции (10 мкг / мл, 5 мкг / мл)
Реагент CSIB (ACE2) Schmidt et al., 2020
Реагент рекомбинантной ДНК pHIV NL GagPol Schmidt et al., 2020
Реагент рекомбинантной ДНК pCCNano pCCNano
Реагент рекомбинантной ДНК pSARS-CoV-2Δ19 Schmidt et al., 2020 Плазмида экспрессии, содержащая усеченный на С-конце белок SARS-CoV-2 S (pSARS-CoV-2Δ19), содержащий синтетический человеческий- кодон-оптимизированная кДНК (Geneart)
Реагент рекомбинантной ДНК R346S Schmidt et al., 2020, и эта статья pSARS-CoV-2Δ19
, содержащая указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК R346K Schmidt et al., 2020, и этот документ pSARS-CoV-2Δ19
, содержащий указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК V367F Schmidt et al., 2020, и этот документ pSARS-CoV-2Δ19
, содержащий указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК N439K Schmidt et al., 2020, и этот документ pSARS-CoV-2Δ19
, содержащий указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент rRкомбинантной ДНК N440K Schmidt et al., 2020, и эта статья pSARS-CoV-2Δ19
, содержащая указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК K444Q Schmidt et al., 2020, и эта статья pSARS-CoV-2Δ19
, содержащая указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК K444R Schmidt et al., 2020, и этот документ pSARS-CoV-2Δ19
, содержащий указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК K444N Schmidt et al., 2020, и эта статья pSARS-CoV-2Δ19
, содержащая указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК V445I Schmidt et al., 2020, и этот документ pSARS-CoV-2Δ19
, содержащий указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК V445E Schmidt et al., 2020, и этот документ pSARS-CoV-2Δ19
, содержащий указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК V445L Schmidt et al., 2020, и этот документ pSARS-CoV-2Δ19
, содержащий указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК V445K Schmidt et al., 2020, и этот документ pSARS-CoV-2Δ19
, содержащий указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК G446V Schmidt et al., 2020, и эта статья pSARS-CoV-2Δ19
, содержащая указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК G446S Schmidt et al., 2020, и этот документ pSARS-CoV-2Δ19
, содержащий указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК L455R Schmidt et al., 2020, и эта статья pSARS-CoV-2Δ19
, содержащая указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК L455I Schmidt et al., 2020 и этот документ pSARS-CoV-2Δ19
, содержащий указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК L455F Schmidt et al., 2020, и этот документ pSARS-CoV-2Δ19
, содержащий указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК F456V Schmidt et al., 2020, и этот документ pSARS-CoV-2Δ19
, содержащий указанную мутацию.
Запросы следует направлять по адресу P.Bieniasz
Реагент рекомбинантной ДНК A475V Schmidt et al., 2020, и этот документ pSARS-CoV-2Δ19
, содержащий указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК A475D Schmidt et al., 2020 и эта статья pSARS-CoV-2Δ19
, содержащая указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК G476A Schmidt et al., 2020, и этот документ pSARS-CoV-2Δ19
, содержащий указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК G476S Schmidt et al., 2020, и эта статья pSARS-CoV-2Δ19
, содержащая указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК T487I Schmidt et al., 2020, и этот документ pSARS-CoV-2Δ19
, содержащий указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК V483I Schmidt et al., 2020, и этот документ pSARS-CoV-2Δ19
, содержащий указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК V483A Schmidt et al., 2020 и этот документ pSARS-CoV-2Δ19
, содержащий указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК V483F Schmidt et al., 2020, и этот документ pSARS-CoV-2Δ19
, содержащий указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК E484Q Schmidt et al., 2020, и эта статья pSARS-CoV-2Δ19
, содержащая указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК E484A Schmidt et al., 2020 и этот документ pSARS-CoV-2Δ19
, содержащий указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК E484D Schmidt et al., 2020, и эта статья pSARS-CoV-2Δ19
, содержащая указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК F490S Schmidt et al., 2020, и этот документ pSARS-CoV-2Δ19
, содержащий указанную мутацию.
Запросы следует направлять по адресу:
P.Bieniasz
Реагент рекомбинантной ДНК F490L Schmidt et al., 2020, и эта статья pSARS-CoV-2Δ19
, содержащая указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Рекомбинантный реагент ДНК
Q493K Schmidt et al., 2020, и эта статья pSARS-CoV-2Δ19
, содержащая указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК Q493R Schmidt et al., 2020, и эта статья pSARS-CoV-2Δ19
, содержащая указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК S494P Schmidt et al., 2020 и этот документ pSARS-CoV-2Δ19
, содержащий указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК N501Y Schmidt et al., 2020, и этот документ pSARS-CoV-2Δ19
, содержащий указанную мутацию.
Запросы следует направлять по адресу: P.Bieniasz
Реагент рекомбинантной ДНК V503F Schmidt et al., 2020, и этот документ pSARS-CoV-2Δ19
, содержащий указанную мутацию.
Запросы следует направлять к П. Бьениасу.
Реагент на основе последовательностей endof_M_for This paper ПЦР и праймер для секвенирования CTATCGGCCACTTCAAATGAGCTAG TCATGGAAGTCCACGATTTTGAGAC
Реагент на основе последовательностей Праймер на основе VSV-RBD-F Настоящая бумага Праймер для ПЦР и секвенированияTATATATAC19 CTACGGC19 R праймер Эта статья ПЦР и праймер для секвенирования CAGAGACATTGTGTAGGCAATGATG
Пептид, рекомбинантный белок ACE2-Fc слитый белок Метод слияния ACE2-Fc слитым белком слитым слитым доменом Ig2 Этот документ слитый домен См. Запрос адресовать П.Bieniasz
Пептид, рекомбинантный белок S-6P-NanoLuc Эта статья Конформационно стабилизированная (6P) версия белка SARS-CoV-2 S, слитого с нанолуциферазой См. Материалы и методы. адресован P.Bieniasz
Коммерческий анализ или набор Trizol-LS Thermo Fisher Cat # 10296028
Коммерческий анализ или набор Cattlement III обратный транскриптаз 9019
Коммерческий анализ или набор Фермент Tagment ДНК Nextera TDE1 Illumina Кат. Номер 15027865 0.25 мкл
Коммерческий анализ или набор Буфер ДНК TD Tagment Illumina Кат. № 15027866 1,25 мкл
коммерческий анализ или набор Nextera XT 9019 Набор для индекса 9019 Nextera XT 9019, версия 2 FC-131–2001
Коммерческий анализ или набор KAPA HiFi HotStart ReadyMix KAPA Biosystems Cat # KK2601
Коммерческий анализ или набор Cat
Коммерческий анализ или набор Expi293 Expression System Kit Thermo Fisher Scientific Кат.
Коммерческий анализ или набор 3C протеаза HRV TaKaRa
Коммерческий анализ или набор Блокирующий буфер LI-COR Intercept Licor P / N 927–70001
Коммерческий анализ или набор Dynrabeads Scientific Кат. № 10004D
Коммерческий анализ или набор Пассивный лизис 5X буфер Promega Кат. Кат. № N1150
Программное обеспечение, алгоритм Geneious Prime https: // www.geneious.com/ RRID: SCR_010519 Версия 2020.1.2
Программное обеспечение, алгоритм Язык программирования Python https://www.python.org/
RRID: SCR_008394
Программное обеспечение, алгоритм
pandas 10.5281 / zenodo.3509134 RRID: SCR_018214 Версия 1.0.5
Программное обеспечение, алгоритм 9019.1038 / s41586-020-2649-2 RRID: SCR_008633 Версия 1.18.5
Программное обеспечение, алгоритм matplotlib 10.1109 / MCSE.2007.55 RRID Версия 9019.2 9019.2

Нейтрализаторы конденсата для конденсационных котлов / нагревателей / печей

О нейтрализаторах конденсата

Конденсат, производимый высокоэффективным конденсационным оборудованием, в том числе бытовыми и коммерческими газовыми котлами, водонагревателями и печами, по своей природе имеет низкий pH (кислотный) и представляет собой проблему для канализационных трубопроводов и септических систем.

Зачем нужен нейтрализатор конденсата?

Когда металлические (особенно медные и латунные) дренажные решетки / решетки, канализационные трубы и арматура подвергаются воздействию конденсата, они быстро подвергаются коррозии, что часто приводит к серьезным повреждениям и дорогостоящему ремонту. Хотя трубопроводы из ПВХ гораздо более устойчивы к конденсату этого металла, не всегда можно определить, есть ли металлические (особенно медные) детали дальше по дренажной линии.
Комбинация септической системы с оборудованием с высоким уровнем образования конденсата (т.е. печь) также может представлять проблему, поскольку кислый конденсат убивает полезные бактерии в септических резервуарах и, следовательно, нарушает их нормальное функционирование.
В любом случае преимущества и душевное спокойствие от установки нейтрализатора конденсата намного перевешивают риски его отсутствия.

Часто задаваемые вопросы:

Q: Как выбрать нейтрализатор конденсата подходящего размера?
О: Самый простой способ определить размер нейтрализатора — это определить количество конденсата (в галлонах), производимое конденсационным оборудованием за час.Если эти данные недоступны, производители предлагают использовать рейтинг оборудования в BTU.

В: Что делать, если у меня две установки для производства конденсата?
A: Затем при определении размеров необходимо сложить их расход конденсата (в галлонах в час) или номинальную мощность в БТЕ. Некоторые модели нейтрализаторов поставляются с Y-образным фитингом с зазубринами, специально разработанным для этой цели.

В: Можно ли уменьшить или увеличить нейтрализатор?
О: Занижение размеров возможно только в том случае, если объем производимого конденсата превышает мощность нейтрализатора.Как правило, невозможно увеличить размер нейтрализатора конденсата — среда нейтрализатора просто прослужит дольше, но в противном случае не принесет никакой пользы и не вызовет проблем.

В: Как часто нужно менять нейтрализатор?
О: Это зависит от частоты использования и объема перерабатываемого конденсата. Поскольку оба фактора сильно различаются, производители нейтрализаторов конденсата не предоставляют таких данных и вместо этого предлагают заменять среду по мере необходимости.

Подробнее

Выделение мощных нейтрализующих антител против SARS-CoV-2 и защита от болезней на модели мелких животных

Мы благодарим T.Гилману, А. Салазару и Биосеро за их вклад в создание высокопроизводительных трубопроводов. Мы также благодарим Б. Грэма и Дж. С. Маклеллана за предоставленные материалы. Мы благодарим Л. Уокера за ценные обсуждения рукописей. Мы благодарим всех участников когорты COVID-19 за пожертвования образцов. Финансирование: Эта работа была поддержана наградами NIH CHAVD (UM1 AI144462 для I.A.W., B.B., D.S. и D.R.B.), R01 (AI132317 и AI073148 для D.N.) и K99 (AI145762 для R.K.A.); Центр нейтрализующих антител IAVI; и Фонд Билла и Мелинды Гейтс (OPP 1170236 к I.A.W. и D.R.B., OPP 1183956, J.E.V., и OPP1196345 / INV-008813, D.S. и D.R.B.). Эта работа также была поддержана Фондом Джона и Мэри Ту и Фондом Пендлтона. Вклад авторов: T.F.R., E.L., D.S, J.G.J. и D.R.B. задумал и спроектировал исследование. T.F.R., N.B., E.G., M.P., S.R., S.A.R. и D.M.S. набрали доноров, собрали и обработали образцы плазмы и PBMC. F.Z., A.B., L.Y., M.P. и G.S. проводили ELISA и анализы связывания клеток. F.Z., D.H., N.B., L.Y., M.P., L.P., J.E.V. и J.R. разработали и провели эксперименты по нейтрализации. F.Z., A.B., O.L., C.S., J.W., R.K.A., E.L., D.S. и J.G.J. провели эксперименты по выделению, клонированию, экспрессии и конкуренции антител. W.-t.H., G.S., S.C., R.A., N.C.W., M.Y. и I.A.W. сгенерированные рекомбинантные антигены. T.F.R., L.Y., M.J.R. и J.R.T. провели исследования на животных и измерения вирусной нагрузки КПЦР. T.F.R., F.Z., D.H., N.B., G.S., J.W., J.H., M.J.R., D.N., J.R.T., R.A., B.B., E.L., D.S., J.G.J. и D.Р.Б. разработал эксперименты и проанализировал данные. E.L., D.S., J.G.J. и D.R.B. написал статью, и все авторы рецензировали и редактировали статью. Конкурирующие интересы: D.R.B., D.H., J.G.J., E.L., T.F.R., D.S. и F.Z. указаны как изобретатели в находящихся на рассмотрении патентных заявках, описывающих антитела против SARS-CoV-2. D.R.B. является консультантом IAVI. У всех остальных авторов нет конкурирующих интересов. Доступность данных и материалов: Последовательности антител депонированы в GenBank под номерами доступа от MT594038 до MT594103.Плазмиды антител доступны от D.R.B. в соответствии с соглашением MTA Исследовательского института Скриппса. Эта работа находится под лицензией Creative Commons Attribution 4.0 International (CC BY 4.0), которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии правильного цитирования оригинальной работы. Чтобы просмотреть копию этой лицензии, посетите https://creativecommons.org/licenses/by/4.0/. Эта лицензия не применяется к рисункам / фотографиям / произведениям искусства или другому контенту, включенному в статью, приписываемому третьей стороне; получить разрешение от правообладателя перед использованием такого материала.

Произошла ошибка при настройке пользовательского файла cookie

Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка вашего браузера для приема файлов cookie

Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки вашего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, используйте кнопку «Назад» и примите файлы cookie.
  • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
  • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

Как правило, в cookie-файлах может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

Как часто менять нейтрализатор конденсата: Руководство по техническому обслуживанию

Нейтрализаторы конденсата имеют решающее значение для очистки кислого конденсата от высокоэффективных нагревательных приборов. Без нейтрализатора конденсат может вызвать коррозию фундамента здания, полов и дренажной системы. Правильная установка нейтрализатора — это основа, но только часть решения. Подобно нагревательным приборам, требующим регулярного обслуживания, нейтрализаторы конденсата также должны регулярно обслуживаться путем замены нейтрализующей среды — второй части профилактического решения для защиты от дорогостоящей коррозии.

Как долго длится нейтрализация СМИ?

Хорошо спроектированный нейтрализатор может эффективно работать с высокоэффективными устройствами в течение многих лет при условии, что нейтрализатор регулярно проверяется и среда регулярно заменяется.

Рекомендуемый график замены среды нейтрализатора зависит от множества факторов, таких как кислотность и объем конденсата, выходящего из вашего высокоэффективного устройства. Конденсирующие нагревательные приборы могут образовывать в своем конденсате особо концентрированное количество азотной, серной, сернистой и соляной кислоты.

Чтобы обеспечить своевременную замену среды нейтрализатора, операторы или технические специалисты должны регулярно проверять pH очищенного конденсата, выходящего из нейтрализатора. Однако не все нейтрализаторы одинаковы. Как правило, вы должны менять средства нейтрализации конденсата примерно один или два раза в год.

Что такое нейтрализующие СМИ?

Процесс нейтрализации pH происходит, когда кислоты в конденсате реагируют с щелочным агентом (например,грамм. карбонат кальция, оксид магния) через тесный контакт с поверхностью. Однако реакция не является мгновенной, поэтому критичными являются площадь поверхности и достаточное время контакта с агентом. Мы называем это решающее время, необходимое для достаточной нейтрализации, «временем выдержки».

Известняк

В элементарных решениях по нейтрализации известняковая или мраморная крошка используется для очистки агрессивных сточных вод в различных областях применения. Первые нейтрализаторы в отопительной и водопроводной промышленности переняли старую школу использования таких сред.Однако промышленность осознала, что известняк не совсем подходит для современных высокоэффективных отопительных приборов.

Основное соединение в известняке — карбонат кальция. Когда карбонат кальция реагирует с кислым конденсатом, он образует диоксид углерода, воду и нерастворимые соли. Эти соли покрывают полученный известняк, ухудшая нейтрализующий эффект среды. В результате известняковая среда быстро становится неэффективной и ее необходимо заменять.

Кроме того, из-за своей более низкой эффективности известняк требует гораздо большей площади поверхности и времени выдержки, что требует большего физического пространства для выдержки или емкости для достаточного времени выдержки.Сегодняшние высокоэффективные устройства производят конденсат, который является (i) очень кислым (pH от 2,9 до 4,0) и (ii) в больших объемах (измеряется в галлонах в час). Более того, эти устройства устанавливаются в рабочих условиях, где пространство ограничено, а занимаемая площадь должна быть минимальной (например, подвалы, подвешивание на стене). Важно выбрать нейтрализатор, который не только имеет подходящую конфигурацию и мощность для вашего устройства, но и содержит эффективные нейтрализующие среды — полное решение.

pH Power Pellets ®

Нейтрализатор рядный трубчатый CBM-227

Решения для нейтрализации

JJM® созданы специально для работы, обеспечивая достаточное «время выдержки» для критических систем отопления и водопровода. Кроме того, JJM® использует свои pH Power Pellets®, запатентованную нейтрализующую среду, которую можно найти исключительно в продуктах JJM®. Активным ингредиентом pH Power Pellets® является гидроксид магния, который обеспечивает мощную, быстродействующую среду.Пеллеты pH Power Pellets® имеют форму гальки и предназначены для максимального увеличения поверхностного контакта и обеспечения слоев нейтрализующей способности без нерастворимых солей известняка. Таким образом, pH Power Pellets® рассчитаны на гораздо более длительный срок службы — до двенадцати месяцев.

Как проверить pH конденсата

Конденсат, обработанный нейтрализатором, должен иметь уровень pH не менее 5,0 или уровень, определенный местными правилами водоснабжения, для безопасного сброса. Специалист по обслуживанию может проверить pH конденсата двумя различными методами: с помощью бумажных тест-полосок или цифрового pH-метра.Если конденсат имеет pH менее 5,0, среду нейтрализатора следует немедленно заменить.

pH Paper Testing

Специалисты по обслуживанию могут использовать полоски лакмусовой бумаги, чтобы определить, является ли конденсат кислым. Бумага изменит цвет, если у жидкости низкий pH.

Технические специалисты могут также использовать полоски для тестирования pH, которые более точны, чем лакмусовая бумага. Вместо того, чтобы сообщать, является ли конденсат кислым, он фактически определяет, насколько кислым является вещество.

При измерении pH технический персонал должен взять образец конденсата из выпускного отверстия и поместить полоску в контейнер для образца. Через несколько секунд полоску можно удалить и считать с помощью цветовой диаграммы pH, входящей в комплект для тестирования.

Этот метод недорогой, но может допускать человеческую ошибку. Поскольку люди по-разному видят цвета, тестируемый человек может не точно сопоставить цвет на бумаге с ключом. Человек, проводящий тестирование, также может использовать тест-полоску с истекшим сроком годности или неправильно обращаться с полоской, что приведет к неточным показаниям.

Цифровой pH-метр

Цифровые pH-метры

используют стеклянные электроды для измерения уровня кислотности жидкости. Эти электроды помещаются в контейнер, содержащий тестовый конденсат, и измеритель отображает числовое значение pH.

Для получения наиболее точных показаний электрод должен быть разработан для измерения образцов с низкой ионной силой. За датчиками следует надлежащим образом ухаживать, чтобы избежать неисправности или поломки.

Цифровые pH-метры

дороже бумажных тестов, но они более точны и легче читаются.

Почему необходимо регулярное обслуживание нейтрализаторов

Неочищенный кислый конденсат может быстро разъедать медные трубы, чугунные трубы и бетонный фундамент в жилых и коммерческих зданиях. Нейтрализатор, за которым не ухаживают должным образом, можно сравнить с отсутствием нейтрализатора вообще.

Замена среды внутри нейтрализаторов защищает здания и канализационные системы от коррозии. Это также обеспечивает соблюдение правил сантехники, которые запрещают выпуск неочищенного кислого конденсата в систему сточных вод.Как минимум, сервисные техники должны заменять нейтрализатор ежегодно.

JJM Alkaline Technologies® разрабатывает и производит инновационные решения по нейтрализации конденсата для жилых и небольших коммерческих помещений.

Добавить комментарий

Ваш адрес email не будет опубликован.